Araeoncus crassiceps

(Westring, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Araeoncus

At a glance

Occurrence records1 161

Data sources7

Biological traits8

DNA specimens13

eDNA detections18

Sources7 archives

Databases and archives Araeoncus crassiceps's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 161 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

World Spider Trait DBMasaryk University8 traits · 26 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements26 literature sources8 traits

Occurrence & distributionGBIF1 161 records

Environmental DNA3 datasets · 6 countries18 detections

DNA & barcodingBOLD13 specimens

01Narrative

Het arrogant voorkopje is een spinnensoort in de taxonomische indeling van de hangmatspinnen (Linyphiidae). Het dier behoort tot het geslacht Araeoncus. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1861 door Johan Peter Westring.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 26 sources

Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Gajdoš & Svatoň 2001SLU 2020Henriksen & Hilmo 2015Harvey et al. 2017Hyvärinen et al. 2019Bruun & Lissner 2019Kielhorn 2017Blick & Scheidler 2004Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Liste France 2018Nährig et al. 2003Blick et al. 2016Řezáč et al. 2015Maelfait et al. 1998Staręga et al. 2002Komposch & Steinberger 1999Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀1.75·♂1.7 mm

Predation1

Hunting guildsheet web weavers

Ecology6

Light0.625 mm

Light 2semi-open

Moisture 10.875 mm

Moisture 2humid

Regional IUCN Red List categoryEndangered (EN)

Regional non-IUCN Red List categoryCritically Endangered (1)

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araeoncus crassiceps has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections18

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

22Amostly conserved

30Cmostly conserved

37Amostly conserved

193Cmostly conserved

247Cmostly conserved

268Cmostly conserved

298Amostly conserved

316Amostly conserved

436Gmostly conserved

469Cmostly conserved

478Gmostly conserved

481Amostly conserved

502Amostly conserved

538Gmostly conserved

589Tmostly conserved

631Gmostly conserved

652Tmostly conserved

AAGTTTATATTTTATTTTTGGAGCATGGGCTGCTATAGTAGGAACGGCAATAAGAGTATTAATTCGAATTGAGTTGGGGCAAACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes4

BIN1

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplocephalus mirabilissame family10.2%Diplocephalus permixtussame family10.7%Dicymbium yaginumaisame family10.8%Dicymbium nigrumsame family10.9%Dicymbium libidinosumsame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 161 records

Wild obs. + sensor821

Museum / vouchered340

Origin

Native38

Range

Area of Occupancy AOO1 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 417≤1 km 103≤10 km 225

745 georeferenced · 76 without coordinates

Open the mapobservation + sensor821

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 117≤1 km 32≤10 km 135>10 km 3

287 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence340

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Akademia Pomorska w Słupskulocation not on record	78
Brussels, BE	44
Paro, BT	42
Helsinki, FI	33
SLU Artdatabankenlocation not on record	20
Bern, CH	11
Copenhagen, DK	9
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	9
Tilburg, NL	8
NTNU-VMlocation not on record	7
Ekaterinburg, RU	5
Bonn, DE	5
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
Tartu, EE	3
Uniwersytet w Białymstokulocation not on record	3
NHMOlocation not on record	2
Frankfurt am Main	2
	1
Rovaniemi, FI	1
Centre for Biodiversity Genomicslocation not on record	1
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	1
Natural History Museum, Londonlocation not on record	1
BioFokuslocation not on record	1
MZLUlocation not on record	1

25 institutions · 296 of 340 vouchered records shown · 44 without an institution code

09Environmental DNA18 detections

Where the DNA of Araeoncus crassiceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys3

Countries6

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map6 countries0

Seashore wrackSeegrasgesiebe am OstseestrandSandstrand mit Kies

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 8.30–14.8

Seasonal swing summer↔winter17.4 °C

Max temp (day)13.6 °C 9.90–18.0

Min temp (night)8.70 °C 2.80–11.0

Precipitation84.1 mm/mo 50.6–134

Air humidity61.1 % 56.7–64.2

Moisture balance-6.20 mm/mo

Vapour deficit519 Pa 391–684

Wind speed4.30 m/s

Cloud cover48.3 % 33.4–56.8

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araeoncus crassiceps

At a glance

Sources7 archives

Morphometry1

Predation1

Ecology6

At a glance

Record type1 161 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 161 records