Araecerus fasciculatus

(C.DeGeer, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Anthribidae/Araecerus

At a glance

Occurrence records1 417

Data sources10

Biological traits0

DNA specimens45

eDNA detections37

Sources10 archives

Databases and archives Araecerus fasciculatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 417 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 417 records

Environmental DNA1 datasets · 11 countries37 detections

DNA & barcodingBOLD45 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈475 Mbp

01Narrative

Araecerus fasciculatus, the coffee bean weevil, is a species of beetle belonging to the family Anthribidae. Despite its name, it affects a wide range of stored products and some field crops. Through trade it has become cosmopolitan in its distribution.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araecerus fasciculatus has left across the world's sequence archives.

At a glance

DNA specimens45

BINs4

Marker genes2

eDNA detections37

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

46Cmostly conserved

56Tmostly conserved

100Tmostly conserved

178Amostly conserved

187Amostly conserved

202Gmostly conserved

223Tmostly conserved

232Cmostly conserved

260Cvariable

265Gmostly conserved

268Tvariable

289Cmostly conserved

319Gmostly conserved

325Tmostly conserved

334Avariable

340Cmostly conserved

344Cmostly conserved

361Cmostly conserved

367Tmostly conserved

370Amostly conserved

397Tmostly conserved

409Amostly conserved

412Gmostly conserved

430Amostly conserved

442Tmostly conserved

451Gmostly conserved

460Cmostly conserved

475Tmostly conserved

478Amostly conserved

484Tmostly conserved

490Tmostly conserved

505Cmostly conserved

544Tmostly conserved

568Tmostly conserved

610Tmostly conserved

616Cmostly conserved

625Amostly conserved

628Tmostly conserved

631Cmostly conserved

640Cmostly conserved

CTTATATTTTATTTTTGGTGCTTGAGCAGGAATAATAGGAACATCCTTAAGAATCTTAATTCGAACAGAATTAGGGAATCCCGGGTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes14

BINs4

Most divergent pair4.6%

S.AmericaAfricaAsiaEuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araecerus levipennissame genus17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Araecerus fasciculatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈474 889 699 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Araecerus fasciculatus0.47 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 226×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type1 417 records

Wild obs. + sensor440

Museum / vouchered977

Origin

Native5

Introduced28

Range

Area of Occupancy AOO1 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 194≤1 km 66≤10 km 35>10 km 49

344 georeferenced · 96 without coordinates

Open the mapobservation + sensor440

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 2≤1 km 51≤10 km 58>10 km 55

166 georeferenced · 811 without coordinates

Open the institutions mapphysical evidence977

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mangilao, GU	657
National Biodiversity Institute, Costa Ricalocation not on record	54
Iwate Prefectural Museumlocation not on record	38
Zürich, CH	27
Museums Victorialocation not on record	20
Paro, BT	17
ASUlocation not on record	15
Geneva, CH	13
Australian National Insect Collectionlocation not on record	11
Chiba, JP	11
Australian National Fish Collectionlocation not on record	10
Corporación Colombiana de Investigación Agropecuaria - AGROSAVIAlocation not on record	8
University of Alabamalocation not on record	8
DPIlocation not on record	7
Natural History Museum Rotterdamlocation not on record	7
Sydney, AU	6
CBDClocation not on record	5
Durban Natural Science Museumlocation not on record	4
University Park, US	4
Uniwersytet Wrocławskilocation not on record	4
Wuzhou, CN	3
Cape Town, ZA	3
SLU Artdatabankenlocation not on record	3
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
Colorado State Universitylocation not on record	2
Auckland, NZ	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
SFRAlocation not on record	2
ZSMlocation not on record	2
KwaZulu-Natal Museumlocation not on record	1
MX	1
KCMNlocation not on record	1
CUlocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1

35 institutions · 953 of 977 vouchered records shown · 22 without an institution code

09Environmental DNA37 detections

Where the DNA of Araecerus fasciculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map11 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…Suburban14. Artificial - Terrestrial | 14.2 Pasturel…Urban3. Shrubland | 3.5. Subtropical/Tropical Dry…3. Shrubland | 3.6. Subtropical/Tropical Moi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 10.6–27.2

Seasonal swing summer↔winter7.90 °C

Max temp (day)25.9 °C 15.9–30.3

Min temp (night)20.6 °C 5.10–24.3

Precipitation82.8 mm/mo 21.5–200

Air humidity64.1 % 56.2–68.2

Moisture balance-37.1 mm/mo

Vapour deficit1,023 Pa 614–1,301

Wind speed2.80 m/s

Cloud cover32.6 % 24.1–61.9

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araecerus fasciculatus

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 417 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 417 records