Aradus corticalis

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aradidae/Aradus

At a glance

Occurrence records999

Data sources6

Biological traits1

DNA specimens19

eDNA detections14

Sources6 archives

Databases and archives Aradus corticalis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility999 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF999 records

Environmental DNA1 datasets · 4 countries14 detections

DNA & barcodingBOLD19 specimens

01Narrative

Aradus corticalis is een wants uit de familie van de schorswantsen (Aradidae). De soort werd het eerst wetenschappelijk beschreven door Carl Linnaeus in 1758.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)fungivore

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aradus corticalis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections14

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 81 variable positions, in barcode order

1Tmostly conserved

2Cmostly conserved

6Amostly conserved

7Cmostly conserved

11Tmostly conserved

12Tmostly conserved

13Amostly conserved

14Tmostly conserved

16Tmostly conserved

19Gvariable

20Amostly conserved

21Tmostly conserved

23Tmostly conserved

26Tmostly conserved

27Cmostly conserved

30Gmostly conserved

32Amostly conserved

33Tmostly conserved

35Gmostly conserved

36Tmostly conserved

37Gvariable

38Gmostly conserved

39Gmostly conserved

42Cmostly conserved

43Cmostly conserved

44Tmostly conserved

45Cmostly conserved

47Amostly conserved

48Tmostly conserved

51Gmostly conserved

52Amostly conserved

53Tmostly conserved

54Gmostly conserved

55Amostly conserved

56Amostly conserved

57Tmostly conserved

58Tmostly conserved

61Tmostly conserved

62Cmostly conserved

63Gmostly conserved

64Amostly conserved

65Amostly conserved

67Cmostly conserved

68Gmostly conserved

69Amostly conserved

70Gmostly conserved

71Cvariable

72Tmostly conserved

74Amostly conserved

75Gmostly conserved

77Cmostly conserved

78Amostly conserved

97Gvariable

115Tmostly conserved

142Tmostly conserved

157Amostly conserved

199Gvariable

211Tvariable

220Cvariable

226Gvariable

250Gvariable

268Avariable

277Cvariable

284Cmostly conserved

290Avariable

313Tvariable

322Cvariable

334Avariable

337Cvariable

364Tvariable

376Tmostly conserved

448Cvariable

463Avariable

499Gmostly conserved

514Amostly conserved

553Cvariable

562Tvariable

565Cvariable

607Cvariable

634Gvariable

643Cvariable

TCTTTACTTTTTATTTGGGATATGATCAGGAATAGTGGGAACCTCAATAAGATGAATTATTCGAATCGAGCTAAGACAACCAGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes7

BINs2

Most divergent pair4.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aradus brenskeisame genus15.4%Aradus shermanisame genus15.6%Aradus elburzanussame genus15.7%Aradus debilissame genus16.7%Aradus signaticornissame genus17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type999 records

Wild obs. + sensor527

Museum / vouchered411

Other61

Range

Area of Occupancy AOO2 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 336≤1 km 134≤10 km 39>10 km 4

513 georeferenced · 14 without coordinates

Open the mapobservation + sensor527

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 146≤1 km 161≤10 km 60

367 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence411

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	96
SLU Artdatabankenlocation not on record	87
Jyväskylä, FI	80
Philadelphia, US	25
Metsähallituslocation not on record	11
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	7
ZMAAlocation not on record	7
Sam Noble Oklahoma Museum of Natural Historylocation not on record	6
Tallinn, EE	5
Tartu, EE	4
BioFokuslocation not on record	4
Bavarian State Collection of Zoologylocation not on record	4
National Institute of Biological Resourceslocation not on record	2
Helsinki, FI	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Kuopio, FI	1
Provincia di Livornolocation not on record	1
neflocation not on record	1
MZLUlocation not on record	1

19 institutions · 345 of 411 vouchered records shown · 66 without an institution code

09Environmental DNA14 detections

Where the DNA of Aradus corticalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 9.60–17.2

Seasonal swing summer↔winter20.4 °C

Max temp (day)15.4 °C 12.6–21.8

Min temp (night)7.00 °C 5.70–12.1

Precipitation83.6 mm/mo 69.4–131

Air humidity63.4 % 58.2–63.6

Moisture balance14.3 mm/mo -41.0–44.4

Vapour deficit554 Pa 439–714

Wind speed2.50 m/s 1.80–2.70

Cloud cover42.3 % 34.4–57.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)