Aradus conspicuus

Herrich-Schaeffer, 1835 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aradidae/Aradus

At a glance

Occurrence records435

Data sources6

Biological traits0

DNA specimens28

eDNA detections18

Sources6 archives

Databases and archives Aradus conspicuus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility435 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF435 records

Environmental DNA1 datasets · 6 countries18 detections

DNA & barcodingBOLD28 specimens

01Narrative

Aradus crenatus is a species of flat bug in the family Aradidae. It is found in Central America, North America, and Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aradus conspicuus has left across the world's sequence archives.

At a glance

DNA specimens28

BINs3

Marker genes1

eDNA detections18

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 78 variable positions, in barcode order

5Tmostly conserved

19Cmostly conserved

28Gmostly conserved

34Gmostly conserved

40Gmostly conserved

43Cmostly conserved

64Tmostly conserved

76Tmostly conserved

79Tmostly conserved

91Gmostly conserved

106Cmostly conserved

115Tmostly conserved

157Cmostly conserved

163Tmostly conserved

166Amostly conserved

169Amostly conserved

175Gmostly conserved

178Tmostly conserved

184Gmostly conserved

187Cmostly conserved

196Amostly conserved

197Cmostly conserved

200Gmostly conserved

205Amostly conserved

211Gmostly conserved

214Cmostly conserved

220Gmostly conserved

226Tmostly conserved

229Amostly conserved

241Amostly conserved

271Cmostly conserved

280Tmostly conserved

283Tmostly conserved

284Amostly conserved

286Amostly conserved

293Gmostly conserved

294Tmostly conserved

295Cmostly conserved

319Amostly conserved

328Gmostly conserved

343Amostly conserved

358Cmostly conserved

361Gmostly conserved

373Amostly conserved

376Tmostly conserved

388Amostly conserved

400Cmostly conserved

409Amostly conserved

415Gmostly conserved

433Amostly conserved

455Amostly conserved

460Tmostly conserved

473Amostly conserved

474Gmostly conserved

475Amostly conserved

478Amostly conserved

487Gmostly conserved

490Amostly conserved

499Amostly conserved

502Gmostly conserved

508Cmostly conserved

528Cmostly conserved

535Tmostly conserved

536Cmostly conserved

547Gmostly conserved

548Tmostly conserved

550Gmostly conserved

565Amostly conserved

568Amostly conserved

583Amostly conserved

589Tmostly conserved

592Amostly conserved

604Cmostly conserved

613Tmostly conserved

616Cmostly conserved

631Amostly conserved

634Cmostly conserved

658Tmostly conserved

AACTTTATACTTCTTATTCGGTATATGGTCAGGGATAGTGGGCACCTCAATAAGTTGAATTATTCGAATTGAACTTAGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes11

BINs3

Most divergent pair9.9%

Europe

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type435 records

Wild obs. + sensor368

Museum / vouchered34

Other33

Range

Area of Occupancy AOO1 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 168≤1 km 89≤10 km 44>10 km 5

306 georeferenced · 62 without coordinates

Open the mapobservation + sensor368

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 16≤1 km 2≤10 km 3

21 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
SLU Artdatabankenlocation not on record	18
Bavarian State Collection of Zoologylocation not on record	9
NHMOlocation not on record	2

3 institutions · 29 of 34 vouchered records shown · 5 without an institution code

09Environmental DNA18 detections

Where the DNA of Aradus conspicuus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map6 countries0

Under bark of dead standing Carya tomentosa …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 4.50–14.5

Seasonal swing summer↔winter18.3 °C

Max temp (day)16.1 °C 8.60–18.6

Min temp (night)8.60 °C 0.9–10.0

Precipitation61.5 mm/mo 41.5–107

Air humidity61.5 % 57.8–64.4

Moisture balance12.2 mm/mo

Vapour deficit611 Pa 300–687

Wind speed3.20 m/s

Cloud cover37.1 % 32.7–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)