Aradus betulae

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aradidae/Aradus

At a glance

Occurrence records2 371

Data sources6

Biological traits1

DNA specimens60

eDNA detections39

Sources6 archives

Databases and archives Aradus betulae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 371 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics60 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 371 records

Environmental DNA1 datasets · 9 countries39 detections

DNA & barcodingBOLD60 specimens

01Narrative

De tonderzwamschorswants is een wants uit de familie van de schorswantsen (Aradidae). De soort werd het eerst wetenschappelijk beschreven door Carl Linnaeus in 1758.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)fungivore

05DNA & barcoding60 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aradus betulae has left across the world's sequence archives.

At a glance

DNA specimens60

BINs5

Marker genes1

eDNA detections39

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

7Amostly conserved

31Amostly conserved

43Amostly conserved

115Tmostly conserved

181Gmostly conserved

196Gmostly conserved

223Cmostly conserved

235Cmostly conserved

253Amostly conserved

283Cmostly conserved

325Amostly conserved

328Amostly conserved

337Tmostly conserved

340Cmostly conserved

403Amostly conserved

415Tmostly conserved

418Amostly conserved

430Gmostly conserved

469Cmostly conserved

478Gmostly conserved

547Cmostly conserved

559Gmostly conserved

592Gmostly conserved

625Gmostly conserved

637Cmostly conserved

AACTTTATATTTTTTATTCGGAATATGATCAGGAATAGTAGGAACATCAATAAGATGAATTATTCGAATTGAACTAAGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes18

BINs4

Most divergent pair4.0%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aradus brenskeisame genus9.6%Aradus elburzanussame genus10.8%Aradus debilissame genus11.6%Aradus krueperisame genus14.6%Aradus betulinussame genus14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 371 records

Wild obs. + sensor1 769

Museum / vouchered577

Other25

Range

Area of Occupancy AOO4 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 746≤1 km 350≤10 km 551>10 km 14

1 661 georeferenced · 108 without coordinates

Open the mapobservation + sensor1 769

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 200≤1 km 229≤10 km 98>10 km 2

529 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence577

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	152
Jyväskylä, FI	128
NHMOlocation not on record	73
Metsähallituslocation not on record	45
Philadelphia, US	17
Bavarian State Collection of Zoologylocation not on record	11
Tromsø, NO	11
Helsinki, FI	8
Kuopio, FI	7
CBDClocation not on record	6
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	5
National Institute of Biological Resourceslocation not on record	4
Tallinn, EE	4
ZMAAlocation not on record	3
neflocation not on record	3
ZSMlocation not on record	3
NCMGlocation not on record	2
Research Collection of Ernst Heisslocation not on record	2
BioFokuslocation not on record	2
Tartu, EE	2
MZLUlocation not on record	1
Finnish Museum of Natural History, Zoological Museumlocation not on record	1

22 institutions · 490 of 577 vouchered records shown · 87 without an institution code

09Environmental DNA39 detections

Where the DNA of Aradus betulae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map9 countries0

karikkeesta koivun juurelta

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 4.10–18.0

Seasonal swing summer↔winter20.4 °C

Max temp (day)17.2 °C 8.20–22.4

Min temp (night)9.90 °C 0.1–13.2

Precipitation81.9 mm/mo 50.1–132

Air humidity60.8 % 58.1–64.6

Moisture balance-4.00 mm/mo -59.5–59.6

Vapour deficit581 Pa 314–859

Wind speed2.50 m/s 1.90–4.50

Cloud cover41.2 % 35.6–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aradus betulae

At a glance

Sources6 archives

Diet & foraging1

At a glance

Record type2 371 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 371 records