Aracima muscosa

Butler, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Aracima

At a glance

Occurrence records17

Data sources8

Biological traits0

DNA specimens6

eDNA detections3

Sources8 archives

Databases and archives Aracima muscosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD6 specimens

01Narrative

Aracima is a monotypic moth genus in the family Geometridae. Its only species, Aracima muscosa, is found in Primorye, Amur, Sakhalin, China, Korea and Japan. Both the genus and species were first described by Arthur Gardiner Butler in 1878.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aracima muscosa has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes4

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

97Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACCTCTTTAAGCTTATTAATTCGAGCAGAATTAGGTAATCCAGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dooabia luniferasame family5.5%Dooabia puncticostatasame family5.9%Paramaxates polygraphariasame family7.4%Pachyplocia griseatasame family7.5%Paramaxates posterectasame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18SEF1-alpha

animal barcoderibosomalmarker

08Occurrence & distribution

Record type17 records

Wild obs. + sensor5

Museum / vouchered12

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	6
KIRMlocation not on record	4
KOMlocation not on record	1
University of Marylandlocation not on record	1

4 institutions · 12 of 12 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Aracima muscosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 22.6–24.8

Seasonal swing summer↔winter20.1 °C

Max temp (day)26.9 °C 25.5–26.9

Min temp (night)22.0 °C 18.4–22.0

Precipitation276 mm/mo 201–276

Air humidity69.2 % 66.2–69.2

Moisture balance126 mm/mo 57.8–126

Vapour deficit961 Pa 926–961

Wind speed2.60 m/s 1.90–2.60

Cloud cover40.5 % 40.5–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)