Arachnura melanura

Simon, 1867 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Arachnura

At a glance

Occurrence records101

Data sources8

Biological traits2

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Arachnura melanura's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility101 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

World Spider Trait DBMasaryk University2 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF101 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Arachnura melanura, also known as scorpion tailed orb-weaver, black tail spider and drag tail spider is a species of spider in the family Araneidae. It ranges from India to Japan to Sulawesi. It camouflages itself by mimicking fallen flowers, dead leaves and twigs. It replaces the capture spiral of its web daily.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014a

Ecology1

Circadian activitydiurnal

Defence1

Primary defenceCamouflage

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachnura melanura has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P558 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.18%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

15Tmostly conserved

21Amostly conserved

GCTATAGTTGGTACTGCTATAAGAGTTTTAATTCGAATTGAGTTAGGGCAACCTGGTAGATTTTTAGGGGATGATCAGTTATATAATGTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoscona subfuscasame family12.4%Thelacantha brevispinasame family12.5%Dipoena lanasame order13.3%Gasteracantha sacerdotalissame family13.6%Dipoena malkinisame order13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type101 records

Wild obs. + sensor94

Museum / vouchered7

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 36≤1 km 26≤10 km 4>10 km 4

70 georeferenced · 24 without coordinates

Open the mapobservation + sensor94

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	2
Frankfurt am Main	2
BMNHlocation not on record	1

3 institutions · 5 of 7 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Arachnura melanura was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 18.9–18.9

Seasonal swing summer↔winter9.90 °C

Max temp (day)22.0 °C

Min temp (night)14.7 °C

Precipitation328 mm/mo

Air humidity65.8 %

Moisture balance229 mm/mo

Vapour deficit751 Pa

Wind speed0.9 m/s

Cloud cover47.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)