Arachnothera flavigaster

(Eyton, 1839) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Nectariniidae/Arachnothera

At a glance

Occurrence records6 034

Data sources8

Biological traits23

DNA specimens6

eDNA detections3

Sources8 archives

Databases and archives Arachnothera flavigaster's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 034 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF6 034 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD6 specimens

01Narrative

The spectacled spiderhunter (Arachnothera flavigaster) is a species of bird in the family Nectariniidae. It is found in Brunei, Indonesia, Malaysia, Singapore, Thailand, and Vietnam. Its natural habitats are subtropical or tropical moist lowland forest and subtropical or tropical moist montane forest. This is both the largest spiderhunter and the largest representative of the entire sunbird family. The total length of this species is around 22 cm and body mass is around 38.4 to.Cheke, R. and C. Mann (2020). Spectacled Spiderhunter (Arachnothera flavigaster), version 1.0. In Birds of the World (J. del Hoyo, A. Elliott, J. Sargatal, D. A. Christie, and E. de Juana, Editors). Cornell Lab of Ornithology, Ithaca, NY, USA.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology12

Beak depth6 mm

Beak length (culmen)40.3 mm

Beak length (nares)31.9 mm

Beak width7.4 mm

Body mass38.4 g

Body mass (female)38.4 g

Hand-wing index18.2

Kipp's distance18.7 mm

Secondary length83.6 mm

Tail length44.5 mm

Tarsus length20.4 mm

Wing length102 mm

Diet & foraging7

Canopy30 %

Fruit30 %

Invertebrate40 %

Midhigh70 %

Nectar30 %

Trophic levelomnivore

Trophic nicheOmnivore

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size1 166 970 km²

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachnothera flavigaster has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

79Gvariable

82Cvariable

109Avariable

202Tvariable

250Gvariable

307Gvariable

427Gvariable

544Tvariable

TCTGTACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGCACCGCCCTAAGCCTTCTCATTCGAGCAGAACTAGGACAGCCCGGAGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes3

BIN1

Most divergent pair0.92%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Prionochilus maculatussame order11.3%Spizella brewerisame order11.5%Cyanomitra verticalissame family11.7%Pheugopedius corayasame order11.8%Spizelloides arboreasame order11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND2

animal barcodemitochondrial

08Occurrence & distribution

Record type6 034 records

Wild obs. + sensor5 961

Museum / vouchered73

Origin

Native6

Range

Area of Occupancy AOO2 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 80≤1 km 72≤10 km 32>10 km 19

203 georeferenced · 5 758 without coordinates

Open the mapobservation + sensor5 961

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 3≤1 km 6≤10 km 22>10 km 17

48 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	15
Washington, US	8
US	6
Ann Arbor, US	6
Philadelphia, US	5
Cambridge, US	5
Toronto, CA	4
Brussels, BE	4
RBINS-Scientific Heritagelocation not on record	3
Wuzhou, CN	2
Zografou, GR	2
Copenhagen, DK	2
Honolulu, US	2
Geneva, CH	1
Louisiana State University, Museum of Zoologylocation not on record	1
NHMOlocation not on record	1

16 institutions · 67 of 73 vouchered records shown · 6 without an institution code

09Environmental DNA3 detections

Where the DNA of Arachnothera flavigaster was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.8–24.8

Seasonal swing summer↔winter1.10 °C

Max temp (day)28.1 °C

Min temp (night)21.8 °C

Precipitation401 mm/mo

Air humidity71.3 %

Moisture balance269 mm/mo

Vapour deficit893 Pa

Wind speed0.7 m/s

Cloud cover60.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arachnothera flavigaster

At a glance

Sources8 archives

Size & morphology12

Diet & foraging7

Habitat & environment4

At a glance

Record type6 034 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 034 records