Arachnocephalus vestitus

Costa, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Mogoplistidae/Arachnocephalus

At a glance

Occurrence records2 144

Data sources10

Biological traits0

DNA specimens25

eDNA detections1

Sources10 archives

Databases and archives Arachnocephalus vestitus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 144 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 144 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD25 specimens

Genome at a glanceGoaT · NCBI≈3.1 Gbp

01Narrative

Arachnocephalus vestitus is een rechtvleugelig insect uit de familie Mogoplistidae. De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd in 1855 door Costa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachnocephalus vestitus has left across the world's sequence archives.

At a glance

DNA specimens25

BINs7

Marker genes2

eDNA detections1

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 59 variable positions, in barcode order

7Amostly conserved

10Cmostly conserved

19Tmostly conserved

40Amostly conserved

61Tmostly conserved

88Amostly conserved

100Avariable

103Cmostly conserved

121Tmostly conserved

136Tmostly conserved

142Tmostly conserved

154Cmostly conserved

166Amostly conserved

175Amostly conserved

181Gmostly conserved

184Amostly conserved

190Tvariable

196Gvariable

202Tmostly conserved

211Amostly conserved

214Avariable

217Avariable

232Cmostly conserved

235Cmostly conserved

256Tmostly conserved

271Cvariable

298Tmostly conserved

301Cvariable

319Amostly conserved

349Amostly conserved

364Cvariable

368Gmostly conserved

379Amostly conserved

397Cvariable

401Cmostly conserved

428Cmostly conserved

430Amostly conserved

433Gmostly conserved

436Cmostly conserved

439Cmostly conserved

442Cmostly conserved

445Cmostly conserved

448Tmostly conserved

478Tmostly conserved

508Tmostly conserved

517Amostly conserved

523Cmostly conserved

538Amostly conserved

542Cmostly conserved

562Tvariable

568Cvariable

574Avariable

595Tmostly conserved

610Tmostly conserved

613Tmostly conserved

631Avariable

634Tvariable

640Tmostly conserved

652Cmostly conserved

AACCCTATACTTTATTTTTGGAGCCTGAGCAGGTATATTAGGAACTTCTATAAGTATTCTTATTCGTACTGAATTAGGTCATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes6

BINs7

Most divergent pair7.3%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pterostichus ordinariussame order15.5%Eunemobius melodiussame order16.3%Pterostichus mandibularoidessame order16.7%Eunemobius carolinussame order16.9%Chlaenius platyderussame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Arachnocephalus vestitus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈3 087 372 040 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arachnocephalus vestitus3.09 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type2 144 records

Wild obs. + sensor2 121

Museum / vouchered14

Other9

Origin

Native4

Range

Area of Occupancy AOO5 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 681≤1 km 424≤10 km 478>10 km 98

1 681 georeferenced · 440 without coordinates

Open the mapobservation + sensor2 121

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 4≤1 km 3≤10 km 2

9 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Bonn, DE	1
Bavarian State Collection of Zoologylocation not on record	1
ORTHATlocation not on record	1
Radicondoli, IT	1

5 institutions · 6 of 14 vouchered records shown · 8 without an institution code

09Environmental DNA1 detections

Where the DNA of Arachnocephalus vestitus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arachnocephalus vestitus

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 144 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 144 records