Arachnis picta

Packard, 1864 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Arachnis

At a glance

Occurrence records3 441

Data sources7

Biological traits0

DNA specimens40

eDNA detections38

Sources7 archives

Databases and archives Arachnis picta's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 441 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 441 records

Environmental DNA1 datasets · 2 countries38 detections

DNA & barcodingBOLD40 specimens

01Narrative

Arachnis picta, the painted tiger moth, is a moth of the family Erebidae. The species was first described by Alpheus Spring Packard in 1864. It is found in the Southwestern United States and the bordering parts of Mexico. The wingspan is about 50 mm. The moth flies during the summer. The larvae feed on herbaceous plants, such as Lupinus, radish and Acanthus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachnis picta has left across the world's sequence archives.

At a glance

DNA specimens40

BINs6

Marker genes1

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

22Avariable

28Gmostly conserved

31Avariable

34Amostly conserved

67Avariable

85Avariable

100Tmostly conserved

115Tmostly conserved

133Tvariable

160Gvariable

166Amostly conserved

181Gvariable

202Cvariable

205Tvariable

211Avariable

214Avariable

217Gmostly conserved

220Cvariable

229Amostly conserved

232Tvariable

322Amostly conserved

328Gvariable

403Avariable

421Tmostly conserved

436Tmostly conserved

463Tvariable

478Cmostly conserved

490Tmostly conserved

499Tmostly conserved

511Avariable

514Avariable

535Tvariable

544Cvariable

550Tvariable

553Avariable

556Cvariable

574Cmostly conserved

601Cmostly conserved

610Tmostly conserved

619Amostly conserved

628Gmostly conserved

637Tmostly conserved

640Tmostly conserved

643Cmostly conserved

646Cmostly conserved

652Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGGGCAGGAATAGTAGGAACTTCACTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes22

BINs6

Most divergent pair4.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arachnis citrasame genus2.3%Spilosoma vaganssame family6.8%Arctia ungemachisame family7.1%Spilosoma pteridissame family7.3%Arctia tigrinasame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 441 records

Wild obs. + sensor2 569

Museum / vouchered872

Range

Area of Occupancy AOO5 948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 562≤1 km 269≤10 km 145>10 km 192

2 168 georeferenced · 401 without coordinates

Open the mapobservation + sensor2 569

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 51≤1 km 79≤10 km 411>10 km 81

622 georeferenced · 250 without coordinates

Open the institutions mapphysical evidence872

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	302
Santa Barbara Museum of Natural Historylocation not on record	111
Provo, US	104
San Diego, US	72
Colorado State Universitylocation not on record	67
East Lansing, US	39
Washington, US	24
University of Alberta Museums (UAM)location not on record	14
San Francisco, US	13
Mississippi State, US	13
US	12
Awka, NG	10
University of Alabamalocation not on record	9
München, DE	8
St. Paul, US	8
US	7
Natural History Museum of Utahlocation not on record	7
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
Ciudad de México, MX	6
Chicago, US	5
Smithsonian Institution, National Museum of Natural Historylocation not on record	4
OSUClocation not on record	3
Georgia Museum of Natural Historylocation not on record	3
Philadelphia, US	3
Denver, US	2
Essig Museum of Entomologylocation not on record	2
Lubbock, US	1
Cambridge, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
ASUlocation not on record	1
Santa Cruz, US	1
Albuquerque, US	1

32 institutions · 861 of 872 vouchered records shown · 11 without an institution code

09Environmental DNA38 detections

Where the DNA of Arachnis picta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map2 countries0

PinesMarsh

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 15.0–20.2

Seasonal swing summer↔winter7.20 °C

Max temp (day)21.4 °C 17.4–25.7

Min temp (night)13.8 °C 11.6–16.0

Precipitation34.6 mm/mo 10.6–73.0

Air humidity59.6 % 48.3–63.9

Moisture balance-45.4 mm/mo

Vapour deficit760 Pa 730–1,059

Wind speed2.90 m/s

Cloud cover22.4 % 18.2–29.0

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arachnis picta

At a glance

Sources7 archives

At a glance

Record type3 441 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 441 records