Arachis monticola

Krapov. & Rigoni · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Arachis

At a glance

Occurrence records92

Data sources9

Biological traits11

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Arachis monticola's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility92 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF92 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · NCBI2.9 Gbp

01Narrative

Arachis monticola is a close relative of the domesticated peanut (Arachis hypogaea). Besides the peanut, it is the only other tetraploid species in the genus Arachis. It is thought to be the immediate wild ancestor of peanut, although it may be a weedy form, descended from cultivated peanuts.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 600 m

Elevation min1 200 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachis monticola has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ555558.1 ↗202 bp

ACGT

TCGATGCCGCACAAACCAGGATTGACGCGCGAACGAGTCCACAAACACCCGAGGCGGGGAAGGTCAGGCCGTGCGCGGCCGGCGCCCTGT …

Arachis monticola internal trascribed spacer 1 (ITS1)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Arachis monticola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 923 731 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arachis monticola2.92 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidy4× tetraploid · measured

Chromosome records20–402n range40median40mode15records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 4014×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Cai, Q., S. Lu & C. C. Chinnappa. 1987. Analysis of karyotypes and Giemsa C-banding patterns in eight species of Arachis. Genome 29: 187–194.

CCDB · ipcn-api-dl — Stalker, H. T. & R. D. Dalmacio. 1986. Karyotype analysis and relationships among varieties of Arachis hypogaea L. Cytologia 51: 617–629.

CCDB · ipcn-api-dl — Lin, Z. p., S. s. Liu & Z. h. Zhu. 1989. An analysis of karyotypes in wild species and culti-species of Arachis. J. Guangzhou Teachers Coll. 1: 59–64.

CCDB · ipcn-api-dl — Wu, A. z. & Y. x. Zhan. 1991. Karyotype analysis of cultivated and wild species in genus Arachis L. J. Shanghai Agric. Coll. 9(4): 307–320.

CCDB · ipcn-api-dl — Fernández, A. & A. Krapovikas. 1994. Cromosomas y evolucio|3n en Arachis (Leguminosae). Bonplandia (Corrientes) 8: 187–220.

CCDB · ipcn-api-dl — Raina, S. N. & Y. MUKAI. 1999. Genomic in situ hybridization in Arachis (Fabaceae) identifies the diploid wild progenitors of cultivated (A. hypogaea) and related wild (A. monticola) peanut species. Pl. Syst. Evol. 214: 251–262.

CCDB · book-ipcn73-74 — MUKHERJI, c. 1973. Cytological investigations of certain species of Arachis. Proc. Indian Sci. Congr. Assoc. 60(III): 313.

CCDB · kew — Temsch EM, Greilhuber J. 2000. Genome size variation in Arachis hypogaea and A. monticola re- evaluated. Genome 43: 449-451.

CCDB · Cave1957 — Krapov. & Rigoni

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Stalker, H. T. 1991. A new species in section Arachis of peanuts with a D genome. Amer. J. Bot. 78: 630–637.

n 202×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Raman, V. S. 1981. Nature of chromosome pairing in allopolyploids of Arachis and their stability. Cytologia 46: 307–321.

CCDB · book-ipcn73-74 — MUKHERJI, c. 1973. Cytological investigations of certain species of Arachis. Proc. Indian Sci. Congr. Assoc. 60(III): 313.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type92 records

Wild obs. + sensor1

Museum / vouchered39

Cultivated / captive4

Other48

Origin

Native34

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence39

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Isidro, AR	12
Corrientes, AR	4
San Jose State University, Museum of Birds and Mammalslocation not on record	4
University of Stellenboschlocation not on record	3
ASUlocation not on record	2
Brasília, BR	1
Bronx, US	1
Kew, GB	1
Glocation not on record	1
Saint Louis, US	1
Fundación Miguel Lillolocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1

12 institutions · 32 of 39 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)