Arachis glabrata

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Arachis

At a glance

Occurrence records915

Data sources12

Biological traits16

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Arachis glabrata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility915 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF915 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT5.7 Gbp

01Narrative

Arachis glabrata (creeping forage peanut, rhizoma peanut, rhizoma perennial peanut, perennial forage peanut, golden glory, ornamental peanut grass) is a high-quality forage plant native to Argentina, Brazil, and Paraguay vegetation. This plant is also used for soil conservation and as an ornamental plant. It is often cultivated together as a following grass species: Axonopus affinis, Axonopus fissifolius, Brachiaria decumbens, Cynodon dactylon, Digitaria eriantha, Paspalum nicorae, and Paspalum notatum. These legume species are also cited as a companion species: Aeschynomene villosa, Medicago sativa, and Trifolium repens.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.3 m

⚠ sources differ — GIFT: 0.3 m · TRY: 0.396 m

Life cycle & reproduction3

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTÁrea Antrópica, Campo Limpo, Cerrado (lato sensu)

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition1 compounds

Compounds documented for Arachis glabrata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachis glabrata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ549364.1 ↗202 bp

ACGT

TCGATGCCGCACAAACCAGGATTGACGCGCGAACGAGTCCACAAACACCCGAGGCGGGGAAGGCCCGGCCGTGCGCGGCGGGCGCCCTGT …

Arachis glabrata partial ITS1, isolate pAglab-17

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Arachis glabrata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 672 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Arachis glabrata5.67 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidy4× tetraploid · measured

Chromosome records20–402n range40median40mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 4010×GoaT · Kew Plant DNA C-values Database · CCDB · croinout · CCDB · ipcn-api-dl +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · croinout — Lavia, G. I. 1996

CCDB · croinout — Fernndez, A. & Krapovickas A. 1994

CCDB · ipcn-api-dl — Fernández, A. & A. Krapovikas. 1994. Cromosomas y evolucio|3n en Arachis (Leguminosae). Bonplandia (Corrientes) 8: 187–220.

CCDB · ipcn-api-dl — Stalker, H. T. 1985. Cytotaxonomy of Arachis. Pp. 65--79 in Proceedings of an International Workshop on Cytogenetics of Arachis (1983).

CCDB · ipcn-api-dl — Tan, R. h., H. q. Zhou & J. y. Cai. 1990. Analysis of karyotypes and evolution of wild species in genus Arachis. Oil Crops China (1): 4–9.

CCDB · book-ipcn73-74 — MUKHERJI, c. 1973. Cytological investigations of certain species of Arachis. Proc. Indian Sci. Congr. Assoc. 60(III): 313.

CCDB · iapt — IAPT/IOPB Chromosome Data 17

CCDB · kew — Singh KP, Raina SN, Singh AK. 1996. Variation in chromosomal DNA associated with the evolution of Arachis species. Genome 39, 890-897.

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Fernández, A. & A. Krapovikas. 1994. Cromosomas y evolucio|3n en Arachis (Leguminosae). Bonplandia (Corrientes) 8: 187–220.

n 202×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Raman, V. S. 1981. Nature of chromosome pairing in allopolyploids of Arachis and their stability. Cytologia 46: 307–321.

CCDB · book-ipcn73-74 — MUKHERJI, c. 1973. Cytological investigations of certain species of Arachis. Proc. Indian Sci. Congr. Assoc. 60(III): 313.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type915 records

Wild obs. + sensor83

Museum / vouchered381

Cultivated / captive3

Other448

Origin

Native512

Range

Area of Occupancy AOO1 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 56≤1 km 8≤10 km 2>10 km 6

72 georeferenced · 11 without coordinates

Open the mapobservation + sensor83

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 376 without coordinates

Open the institutions mapphysical evidence381

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cenargenlocation not on record	122
UFMSlocation not on record	61
Bronx, US	26
Saint Louis, US	20
Istituto Agrario Castelnuovolocation not on record	15
Paleontological Collectionlocation not on record	14
Tampa, US	13
San Jose State University, Museum of Birds and Mammalslocation not on record	10
University of Stellenboschlocation not on record	10
Jena Microbial Resource Collectionlocation not on record	10
Jataí / Setor Industrial, BR	8
Brasília, BR	7
Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record	7
Salvador, BR	5
Paris, FR	4
South Kensington, GB	4
Kew, GB	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
UNESP-FCAlocation not on record	3
Corrientes, AR	3
Laboratorio de Ictiologialocation not on record	3
IPA/SPlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
San Isidro, AR	2
UNICAMPlocation not on record	2
Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record	2
MAlocation not on record	1
Mississippi State, US	1
Moscow State Universitylocation not on record	1
Feira de Santana, BR	1
GAlocation not on record	1
EL PASO, US	1
Teresina, BR	1
Universidad Nacional de Asunciónlocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
UFBAlocation not on record	1
LDlocation not on record	1
Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record	1
HAWlocation not on record	1
UFPIlocation not on record	1

40 institutions · 377 of 381 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Arachis glabrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)