Arachis duranensis

Krapov. & W.C.Greg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Arachis

At a glance

Occurrence records697

Data sources11

Biological traits11

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Arachis duranensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility697 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF697 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · NCBI1.3 Gbp

01Narrative

Arachis duranensis (syn. Arachis argentinensis Speg., Arachis spegazzinii M.Gregory & W.Gregory) is a herb found in South America, specially in North Argentina, Bolivia, and Paraguay. This plant is cited as gene sources for research in plant biology of peanut (Arachis hypogaea).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 300 m

Elevation min200 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachis duranensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ998318.1 ↗671 bpArgentina · 1953

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCGCACAAACCAGGATTGACGCGCGAACGAGTCCACAA …

Arachis duranensis voucher CEN:A. Krapovickas K 7988 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL7★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Arachis duranensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 330 080 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arachis duranensis1.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode19records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2019×GoaT · Kew Plant DNA C-values Database · CCDB · croinout · CCDB · ipcn-api-dl +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · croinout — Fernndez, A. & Krapovickas A. 1994

CCDB · ipcn-api-dl — PUSHPA, G., K. W. D. Nayar, B. G. S. REDDY & K. G. Shambulingappa. 1983. Studies on the back cross generations of the cross Arachis hypogaea x A. duranensis. Cytologia 48: 505–509.

CCDB · ipcn-api-dl — PUSHPA, G. & B. G. S. Reddy. 1983. Studies on the open pollinated generations of the cross Arachis hypogaea x Arachis duranensis. Cytologia 48: 565–568.

CCDB · ipcn-api-dl — Wu, A. z. & Y. x. Zhan. 1991. Karyotype analysis of cultivated and wild species in genus Arachis L. J. Shanghai Agric. Coll. 9(4): 307–320.

CCDB · ipcn-api-dl — Fernández, A. & A. Krapovikas. 1994. Cromosomas y evolucio|3n en Arachis (Leguminosae). Bonplandia (Corrientes) 8: 187–220.

CCDB · ipcn-api-dl — Kochert, G., H. T. Stalker, M. Gimenes, L. Galgaro, C. R. Lopes & K. Moore. 1996. RFLP and cytogenetic evidence on the origin and evolution of allotetraploid domesticated peanut, Arachis hypogaea (Leguminosae). Amer. J. Bot. 83(10): 1282–1291.

CCDB · ipcn-api-dl — Raina, S. N. & Y. MUKAI. 1999. Genomic in situ hybridization in Arachis (Fabaceae) identifies the diploid wild progenitors of cultivated (A. hypogaea) and related wild (A. monticola) peanut species. Pl. Syst. Evol. 214: 251–262.

CCDB · ipcn-api-dl — Stalker, H. T. & R. D. Dalmacio. 1981. Chromosomes of Arachis species, section Arachis. J. Heredity 72: 403–408.

CCDB · book-ipcn73-74 — SEETHARAM, A., K.M.D. NAYAR., R. SREEKANTARADLYA, & D.K.T. ACHAR. 1973. Cytological studies on the interspecific hybrid of Arachis hypogaea X Arachis duranensis. Cytologia 38: 277-280.

CCDB · book-ipcn73-74 — MUKHERJI, c. 1973. Cytological investigations of certain species of Arachis. Proc. Indian Sci. Congr. Assoc. 60(III): 313.

CCDB · kew — Temsch EM, Greilhuber J. 2001. Genome size in Arachis duranensis: a critical study. Genome 44: 826-830.

CCDB · kew — Resslar PM, Stucky JM, Miksche JP. 1981. Cytophotometric determination of the amount of DNA in Arachis L. sect. Arachis (Leguminosae). American Journal of Botany 68: 149-153.

n 102×CCDB · book-ipcn73-74 · CCDB · Cave1963

CCDB · book-ipcn73-74 — MUKHERJI, c. 1973. Cytological investigations of certain species of Arachis. Proc. Indian Sci. Congr. Assoc. 60(III): 313.

CCDB · Cave1963 — Raman & Kes. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness96.2% BUSCO

08Occurrence & distribution

Record type697 records

Wild obs. + sensor52

Museum / vouchered249

Cultivated / captive37

Other359

Origin

Native252

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 28≤1 km 8≤10 km 3>10 km 2

41 georeferenced · 11 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 247 without coordinates

Open the institutions mapphysical evidence249

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 35 without coordinates

Open the mapnot free-living37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corrientes, AR	62
Cenargenlocation not on record	23
Kew, GB	20
Saint Louis, US	18
ASUlocation not on record	15
Paris, FR	12
San Isidro, AR	11
San Jose State University, Museum of Birds and Mammalslocation not on record	10
USP-IBlocation not on record	6
Ciudad Autónoma de Buenos Aires, AR	5
University of Stellenboschlocation not on record	4
IPA/SPlocation not on record	4
MAlocation not on record	4
Istituto Agrario Castelnuovolocation not on record	3
Bronx, US	3
Cambridge, US	3
JBRJlocation not on record	3
Beijing, CN	2
Laboratorio de Ictiologialocation not on record	2
Hanshan Normal Universitylocation not on record	2
Brasília, BR	2
EL PASO, US	2
Salvador, BR	2
Chicago, US	2
Fundación Miguel Lillolocation not on record	2
Glocation not on record	2
Clemson, US	1
Plocation not on record	1
Guilin, CN	1
Moscow State Universitylocation not on record	1
Brasília, BR	1
Jinghong, CN	1
Castelar, AR	1
Columbia, US	1
UFBAlocation not on record	1
Córdoba, AR	1
Taipei, TW	1
Calabar, NG	1
MEXUlocation not on record	1

39 institutions · 237 of 249 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Arachis duranensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)