Arabis scabra

All. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Arabis

At a glance

Occurrence records3 649

Data sources9

Biological traits15

DNA specimens11

eDNA detections6

Sources9 archives

Databases and archives Arabis scabra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 649 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF3 649 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB · GoaT411 Mbp

01Narrative

L'Arabette scabre, ou Arabis scabra, est une espèce de plante à fleurs du genre Arabis et de la famille des brassicacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.03 m

Seed mass0.271 mg

Seed mass max0.3 mg

Seed mass min0.24 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

⚠ sources differ — TRY: Perennial · GIFT: biennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arabis scabra has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes4

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN453806.1 ↗153 687 bp

ACGT

CATAATAACTTGGTCCCGGGCGAACGACGGGAATTGAACCCGCGATGGTGAATTCACAATCCACTGCCTTAATCCACTTGGCTACATCCG …

Arabis scabra plastid, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL10★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Arabis scabra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size410 760 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arabis scabra0.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 169×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +4

GoaT · DTOL Flowering Plants Estimates Kew

CCDB · brit-fl — Pring, M.E. J. Ecol. 49: 431-437 (1961)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2318

CCDB · fl-europaea — Jones, 1963

CCDB · ipcn-api-dl — Koch, M., J. Bishop & T. Mitchell-Olds. 1999. Molecular systematics and evolution of Arabidopsis and Arabis. Pl. Biol. (Stuttgart) 1: 529–537.

CCDB · brass — Pring

CCDB · brass — Koch et al.

CCDB · CromoCat 2015 — Burdet, H. M. (1967). Contribution à l'étude caryologique des genres Cardaminopsis, Turitis et Arabis en Europe. Candollea 22(1): 107-156.

CCDB · CromoCat 2015 — Koch, M., Bishop, J. & Mitchell-Olds, T. (1999). Molecular systematics and evolution of Arabidopsis and Arabis Plant Biology 1: 529-537

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 649 records

Wild obs. + sensor3 045

Museum / vouchered597

Other7

Origin

Native144

Introduced13

Range

Area of Occupancy AOO5 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 381≤1 km 560≤10 km 1 619>10 km 5

2 565 georeferenced · 480 without coordinates

Open the mapobservation + sensor3 045

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 12≤1 km 219≤10 km 146>10 km 3

380 georeferenced · 217 without coordinates

Open the institutions mapphysical evidence597

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	109
València, ES	47
Vitoria, ES	43
BMlocation not on record	42
MAlocation not on record	42
San Sebastián, ES	36
Barcelona, ES	25
BDBClocation not on record	22
Universidad del Pais Vasco (UPV/EHU)location not on record	20
Elocation not on record	19
Entomological Society of Latvialocation not on record	16
CJBGlocation not on record	15
BClocation not on record	11
University of Birminghamlocation not on record	9
LIVlocation not on record	9
Salamanca, ES	6
Pamplona, ES	5
University of Hulllocation not on record	3
Pamplona, ES	3
National Museum Waleslocation not on record	3
Madrid, ES	2
Harrow Schoollocation not on record	2
Museo Achille Folettolocation not on record	2
College of the Atlantic, Museumlocation not on record	2
OLAlocation not on record	2
Porrentruy, CH	2
NMWlocation not on record	2
Bourges, FR	2
BM\|HLUlocation not on record	1
BIRM\|LIVlocation not on record	1
Wlocation not on record	1
CICYTEXlocation not on record	1
Kew, GB	1
Royal Botanic Gardens, Kewlocation not on record	1
Gijón, ES	1
LDlocation not on record	1
Tilburg, NL	1

37 institutions · 510 of 597 vouchered records shown · 87 without an institution code

09Environmental DNA6 detections

Where the DNA of Arabis scabra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Rare Plants Nursery, Grown in polytunnel

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 6.70–12.4

Seasonal swing summer↔winter11.9 °C

Max temp (day)15.9 °C 9.70–16.1

Min temp (night)7.90 °C 3.00–8.10

Precipitation68.6 mm/mo 67.4–115

Air humidity60.7 % 60.4–67.7

Moisture balance-31.3 mm/mo -31.5–45.1

Vapour deficit560 Pa 339–571

Wind speed3.40 m/s 3.10–5.90

Cloud cover44.6 % 44.6–46.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arabis scabra

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 649 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 649 records