Arabis kennedyae

Meikle · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Arabis

At a glance

Occurrence records3

Data sources7

Biological traits3

DNA specimens30

eDNA detections30

Sources7 archives

Databases and archives Arabis kennedyae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF3 records

Environmental DNA1 datasets · 0 countries30 detections

DNA & barcodingBOLD · NCBI30 specimens

01Narrative

Arabis kennedyae (лат.) — вид цветковых растений рода Резуха (Arabis) семейства Капустные (Brassicaceae). Этот вид растений впервые был обнаружен ботаником Эммелиной Кеннеди в 1938 году у местечка Ксероколимбос, описан в 1962 году автором «Флоры Кипра» ирландским ботаником Робертом Десмондом Мейкле. Видовой эпитет растению дан в честь Эммелины Кеннеди. Эндемик Кипра. Встречается на высотах 900—1 350 метров над уровнем моря на склонах горы Трипилос в горной системе Троодос. Произрастает в средиземноморских зарослях кустарников. Находится под угрозой исчезновения из-за сокращения мест обитания. Однолетнее или двулетнее травянистое растение от 5 до 30 см в высоту, заселяет скалистые склоны. Предпочитает затенённые участки у воды, часто селится в тени дуба ольхолистного и сосны калабрийской. В более влажные годы растение лучше переживает период летней засухи. Семена распространяются ветром или разносятся водами окрестных ручьёв и рек. В связи с зависимостью длительности жизни растения от погодных условий численность популяции сильно меняется из года в год, в связи с чем возникают сложности при мониторинге состояния вида.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass0.12 mg

Life cycle & reproduction1

Life formannual or biennial

Habitat & environment1

Climatetemperate

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arabis kennedyae has left across the world's sequence archives.

At a glance

DNA specimens30

Marker genes2

GenBank sequences10

eDNA detections30

The DNA barcodea real sequence read deposited for this species

matKGU458382.1 ↗699 bp

ACGT

TACCTTACCCGATCCATCTAGAAATCTTGGTTCAAACCCTACGTTACCGGGTAAAAGATGCCTCTTCGTTGCATTTTTTTCGGCTCTGTC …

Arabis kennedyae isolate AR2-7 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK10★ITS

plant barcodefungal barcode

08Occurrence & distribution

Record type3 records

Wild obs. + sensor1

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA30 detections

Where the DNA of Arabis kennedyae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)