Arabis hirsuta
(L.) Scop. · speciesAt a glance
Occurrence records89 803
Data sources12
Biological traits55
DNA specimens52
eDNA detections42
Sources12 archives
Databases and archives Arabis hirsuta's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility89 803 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics52 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources55 traits
Chemical compositionNPASS15 compounds
Occurrence & distributionGBIF89 803 records
Environmental DNA2 datasets · 12 countries42 detections
DNA & barcodingBOLD · NCBI52 specimens
Genome at a glanceCCDB · GoaT · NCBI694 Mbp
01Narrative
L’Arabette hérissée ou Arabette hirsute est une espèce de plantes herbacées appartenant à la famille des Brassicacées. C'est une plante bisannuelle ou vivace à petites fleurs blanches.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology18
Fruit length50 mm
Fruit length max65 mm
Fruit length min35 mm
Leaf length35 mm
Leaf length max50 mm
Leaf length min20 mm
Leaf mass15.76 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 374 mm² · GIFT: 374 mm²
Leaf width max13 mm
Leaf width min7 mm
Plant height0.462 m
⚠ sources differ — GIFT: 0.462 m · LEDA: 0.34 m · TRY: 0.35 m
Plant height generative0.375 m
Plant height max0.9 m
Plant height min0.3 m
Seed length1.48 mm
Seed mass0.098 mg
⚠ sources differ — TRY: 0.098 mg · LEDA: 0.098 mg · GIFT: 0.131 mg
Seed mass max0.343 mg
Seed mass min0.03 mg
Life cycle & reproduction14
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endJul
Flowering startMay
Life formbiennial or perennial
Life spanannual
⚠ sources differ — TRY: annual · LEDA: perennials · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number552 042
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 000 m
Elevation mean2 750 m
Elevation min1 500 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
⚠ sources differ — GIFT: herb · TRY: forb-biennial
Habitat GIFTforest, hills, meadows: dry, steppe
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio14.78 g/g
Leaf c447 mg/g
Leaf dry-matter content (LDMC)159 mg/g
Leaf n25.9 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)20.37 mm²/mg
⚠ sources differ — TRY: 20.37 mm²/mg · LEDA: 26.9 mm²/mg · GIFT: 28.1 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Monocarpymonocarp
03Chemical composition15 compounds
Compounds documented for Arabis hirsuta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones8
Guaiane sesquiterpenoids2
Cinnamic acids and derivatives1
2-pyrone derivatives1
4-pyrone derivatives1
Documented compounds15 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2S,3S,4S,5R,6S)-5-acetyloxy-6-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid | present | NPASS | |
| (3aR,6R,6aR,9R,9aR,9bR)-6,9-dihydroxy-6a-methoxy-6,9-dimethyl-3-methylidene-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2-one | present | NPASS | |
| (Z)-2-[(4-hydroxyphenyl)methyl]but-2-enedioic acid | present | NPASS | |
| 1alpha,4beta,10beta-Trihydroxyguaia-2,11(13)-dien-12,6alpha-olide | present | NPASS | |
| 4-(beta-d-Glucopyranosyloxy)-6-methyl-2h-pyran-2-one | present | NPASS | |
| 6-Hydroxyluteolin 6,7,3',4'-tetramethyl ether | present | NPASS | |
| [(2E,5R,8S)-2-hexa-2,4-diynylidene-1,10-dioxaspiro[4.5]dec-3-en-8-yl] acetate | present | NPASS | |
| [(2Z,5R,8R)-2-hexa-2,4-diynylidene-1,10-dioxaspiro[4.5]dec-3-en-8-yl] acetate | present | NPASS | |
| Apigenin 7-O-glucuronide | present | NPASS | |
| Cirsilineol | present | NPASS |
05DNA & barcoding52 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arabis hirsuta has left across the world's sequence archives.
At a glance
DNA specimens52
Marker genes6
GenBank sequences10
eDNA detections42
Countries12
The DNA barcodea real sequence read deposited for this species
ACTTTCCGTAGGGGTGACCTGCGGAAGGATCATTGTCGATACCTGTCCAAAACAGAACAACCCGCGAACGAACGATCATCACTCTCGGTT …
Arabis hirsuta isolate F. Al-Dulaimi12 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL4★rbcLa★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Arabis hirsuta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size694 380 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Arabis hirsuta0.69 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidy4× tetraploid · measured
Chromosome records32–322n range32median32mode7records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 327×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl +1
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — Titz, W. 1978. Experimentelle Systematik und Genetik der kahlen Sippen in der Arabis hirsuta-Gruppe (Brassicaceae). Bot. Jahrb. Syst. 100: 110–139.
CCDB · book-ipcn75-78 — Titz 1978
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.3% BUSCO
08Occurrence & distribution
Record type89 803 records
Wild obs. + sensor80 954
Museum / vouchered7 847
Cultivated / captive23
Other979
Origin
Native6 270
Introduced16
Range
Area of Occupancy AOO118 944 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy36% within 1 km
≤100 m 14 617≤1 km 9 343≤10 km 41 406>10 km 551
65 917 georeferenced · 15 037 without coordinates
Open the mapobservation + sensor80 954
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 429≤1 km 1 294≤10 km 1 898>10 km 645
4 266 georeferenced · 3 581 without coordinates
Open the institutions mapphysical evidence7 847
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 11
13 georeferenced · 10 without coordinates
Open the mapnot free-living23
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions144 of 270 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 573 |
| LDlocation not on record | 400 |
| Helsinki, FI | 387 |
| Trondheim, NO | 379 |
| Uppsala, SE | 344 |
| BIO-UNIPIlocation not on record | 291 |
| TROMlocation not on record | 241 |
| Turku, FI | 187 |
| Salzburg, AT | 155 |
| Bergen, NO | 152 |
| BFLlocation not on record | 142 |
| Tartu, EE | 138 |
| València, ES | 133 |
| Beijing, CN | 124 |
| Odawara, JP | 121 |
| MeiseBGlocation not on record | 114 |
| Shinshu Universitylocation not on record | 104 |
| Adam Mickiewicz University in Poznańlocation not on record | 100 |
| Provincia di Livornolocation not on record | 93 |
| Oskarshamn, SE | 87 |
| Barcelona, ES | 86 |
| Nagano City, JP | 81 |
| BDBClocation not on record | 77 |
| Moscow State Universitylocation not on record | 75 |
| BRNUlocation not on record | 74 |
| TUR-Alocation not on record | 74 |
| Tallinn, EE | 68 |
| Zürich, CH | 68 |
| Mlocation not on record | 68 |
| Kuopio, FI | 66 |
| Olocation not on record | 65 |
| Zürich, CH | 58 |
| Toyama, JP | 58 |
| WTUlocation not on record | 56 |
| Tomioka, JP | 55 |
| Bando, JP | 52 |
| Oulu, FI | 52 |
| Yangling, CN | 48 |
| Bronx, US | 47 |
| Fukushima Universitylocation not on record | 47 |
| South Kensington, GB | 44 |
| MAlocation not on record | 43 |
| University of Alberta Museumslocation not on record | 42 |
| GJOlocation not on record | 42 |
| BClocation not on record | 41 |
| SLU Artdatabankenlocation not on record | 40 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 39 |
| Entomological Society of Latvialocation not on record | 37 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 36 |
| Chengdu, CN | 35 |
| Wlocation not on record | 34 |
| Chiba, JP | 34 |
| Vitoria, ES | 33 |
| Chengdu, CN | 33 |
| Tsukuba, JP | 29 |
| Nanjing, CN | 28 |
| SIHUlocation not on record | 28 |
| Bern, CH | 27 |
| Kunming, CN | 27 |
| Missoula, US | 27 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 27 |
| Sanda, JP | 26 |
| Nagatoro-machi, Chichibu-gun, JP | 26 |
| San Sebastián, ES | 24 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 23 |
| Porrentruy, CH | 23 |
| Spearfish, US | 22 |
| Québec, CA | 22 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 20 |
| Lincoln, US | 20 |
| Omachi Alpine Museumlocation not on record | 19 |
| JP | 19 |
| Iwate Prefectural Museumlocation not on record | 18 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 18 |
| Berlin, DE | 18 |
| Seoul, KR | 18 |
| Uniwersytet Jagiellońskilocation not on record | 17 |
| KR | 17 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 17 |
| Claremont, US | 17 |
| GZUlocation not on record | 17 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 16 |
| Servico de Microbiologia e Imunologialocation not on record | 16 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 16 |
| Kochi, JP | 15 |
| Kyoto Universitylocation not on record | 15 |
| SZUlocation not on record | 13 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 13 |
| Lanzhou, CN | 12 |
| PRClocation not on record | 12 |
| Frauenfeld, CH | 12 |
| Osaka, JP | 12 |
| WINlocation not on record | 12 |
| Karlsruhe, DE | 11 |
| National Institute of Biological Resourceslocation not on record | 11 |
| Toronto, CA | 11 |
| Philadelphia, US | 11 |
| Albuquerque, US | 11 |
| Sant Julià de Lòria, AD | 11 |
| nbflocation not on record | 11 |
| Dresden, DE | 10 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 10 |
| Boise, US | 10 |
| Xining, CN | 10 |
| Bozeman, US | 10 |
| Jyväskylä, FI | 10 |
| Pocatello, US | 9 |
| Görlitz, DE | 9 |
| Provo, US | 9 |
| Kushiro City Museumlocation not on record | 8 |
| Brookings, US | 8 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 8 |
| Tromso University Museumlocation not on record | 8 |
| PrivatHerblocation not on record | 8 |
| Guangzhou, CN | 8 |
| Paris, FR | 7 |
| Podgorica, ME | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| Porvoo, FI | 7 |
| Herb. BBGlocation not on record | 7 |
| Salamanca, ES | 7 |
| IWEP FEB RASlocation not on record | 7 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 7 |
| Portland, US | 7 |
| Beijing, CN | 7 |
| Saint John, CA | 6 |
| Tokushima, JP | 6 |
| BSBIlocation not on record | 6 |
| Riverside, US | 6 |
| Anchorage, US | 6 |
| SWlocation not on record | 6 |
| Glarus, CH | 6 |
| Taipei, TW | 6 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 6 |
| Flagstaff, US | 6 |
| Ishikawa Museum of Natural Historylocation not on record | 6 |
| New Haven, US | 6 |
| Nishihara, JP | 6 |
| College of the Atlantic, Museumlocation not on record | 6 |
| Victoria, CA | 6 |
| Universidad Católica de Santa Maríalocation not on record | 6 |
| KOMlocation not on record | 6 |
| Shanxi Institute of Biologylocation not on record | 5 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 5 |
| Xiamen, CN | 5 |
| Madrid, ES | 5 |
| Pamplona, ES | 5 |
| Gijón, ES | 5 |
| H-Schuhwlocation not on record | 5 |
| H-Hohlalocation not on record | 5 |
| Wuhan, CN | 5 |
| CJBGlocation not on record | 4 |
| Taiyuan Normal Universitylocation not on record | 4 |
| Logan, US | 4 |
| University of Lethbridgelocation not on record | 4 |
| KMNlocation not on record | 4 |
| Elocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| LfUlocation not on record | 4 |
| Jaén, ES | 4 |
| Davenport, US | 4 |
| Pamplona, ES | 4 |
| Tacoma, US | 4 |
| Inner Mongolia Universitylocation not on record | 4 |
| Mississippi State, US | 4 |
| Guilin, CN | 3 |
| H-Meierottlocation not on record | 3 |
| Dekalb, US | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Montréal, CA | 3 |
| National Museum Waleslocation not on record | 3 |
| Knoxville, US | 3 |
| Sion, CH | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Christchurch, NZ | 3 |
| Brussel, BE | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Weber State Universitylocation not on record | 3 |
| Winterthur, CH | 3 |
| Vancouver, CA | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| WNNUlocation not on record | 3 |
| EL PASO, US | 3 |
| Ischia Marine Centrelocation not on record | 3 |
| Bourges, FR | 3 |
| Hudson, US | 2 |
| US | 2 |
| Salvador, BR | 2 |
| Edinburgh, GB | 2 |
| Canberra, AU | 2 |
| Université Lavallocation not on record | 2 |
| Waverly, US | 2 |
| Otaru, JP | 2 |
| ESP003location not on record | 2 |
| Madison, US | 2 |
| College Park, US | 2 |
| Staten Island, US | 2 |
| CICYTEXlocation not on record | 2 |
| Siouxland Heritage Museumlocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Moscow, US | 2 |
| University of Stellenboschlocation not on record | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Alicante, ES | 2 |
| Millersville, US | 2 |
| Korea National Arboretumlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| UGentlocation not on record | 2 |
| Hobart, AU | 2 |
| Saint Louis, US | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| TAIElocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| Wellington, NZ | 1 |
| IDElocation not on record | 1 |
| CASlocation not on record | 1 |
| Banyoles, ES | 1 |
| Washington, US | 1 |
| Guiyang, CN | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Corrientes, AR | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| KNAMlocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Nishihara, JP | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Kew, GB | 1 |
| Miami, US | 1 |
| Cambridge, US | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Philadelphia, US | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Xian, CN | 1 |
| IPE-CSIClocation not on record | 1 |
| Taipei, TW | 1 |
| Monastir, TN | 1 |
| Cheney, US | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Sagamihara, JP | 1 |
| ISAlocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| ENTClocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Mexico City, MX | 1 |
| Bangkok, TH | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| DMZ botanic gardenlocation not on record | 1 |
| St. Paul, US | 1 |
| JBSlocation not on record | 1 |
| Grand Junction, US | 1 |
| GB | 1 |
| ASUlocation not on record | 1 |
| GMBAlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Oswego, US | 1 |
| Pullman, US | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Williamsburg, US | 1 |
| Stockholm, SE | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Fort Worth, US | 1 |
| Bend, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Boumlocation not on record | 1 |
270 institutions · 7 488 of 7 847 vouchered records shown · 333 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA42 detections
Where the DNA of Arabis hirsuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found42
Studies independent surveys2
Countries12
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 42 detections have coordinates
Open the map12 countries0
in abandoned quarry
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.1 °C 7.10–17.4
Seasonal swing summer↔winter19.9 °C
Max temp (day)14.2 °C 9.20–19.4
Min temp (night)8.80 °C 4.20–14.7
Precipitation71.4 mm/mo 58.7–91.9
Air humidity62.4 % 59.8–64.7
Moisture balance-11.5 mm/mo -52.1–52.7
Vapour deficit524 Pa 386–783
Wind speed4.40 m/s 2.60–6.50
Cloud cover44.5 % 34.8–64.0
CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.