Arabis eschscholtziana

Andrz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Arabis

At a glance

Occurrence records555

Data sources9

Biological traits9

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Arabis eschscholtziana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility555 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF555 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 64

01Narrative

Arabis eschscholtziana là một loài thực vật có hoa trong họ Cải. Loài này được Andrz. mô tả khoa học đầu tiên năm 1831.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formbiennial or perennial

Life spanvariable

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arabis eschscholtziana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences8

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG237072.1 ↗310 bpCanada · 1957

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAAATC …

Arabis eschscholtziana voucher CCDB-18304-F07 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLa★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arabis eschscholtziana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 322×CCDB · brass

CCDB · brass — Taylor & Mulligan

CCDB · brass — Rollins

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type555 records

Wild obs. + sensor93

Museum / vouchered462

Origin

Native1

Range

Area of Occupancy AOO1 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 57≤1 km 10≤10 km 2

69 georeferenced · 24 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 21≤1 km 74≤10 km 69>10 km 11

175 georeferenced · 287 without coordinates

Open the institutions mapphysical evidence462

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	143
DAOlocation not on record	54
Corvallis, US	53
Pullman, US	52
Vancouver, CA	28
Moscow, US	25
WTUlocation not on record	22
Claremont, US	17
Wuzhou, CN	6
Anchorage, US	6
CASlocation not on record	6
Pocatello, US	5
Logan, US	5
St. Paul, US	4
Bandelier National Monumentlocation not on record	3
Caldwell, US	3
Boise, US	2
US	2
Ashland, US	2
Henderson, US	2
San Diego, US	2
San Luis Obispo, US	2
Flagstaff, US	2
Santa Barbara, US	2
Phoenix, US	1
Provo, US	1
Arcata, US	1
Bend, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Los Angeles, US	1
Paris, FR	1
Orem, US	1
University of British Columbia, Herbariumlocation not on record	1
Bronx, US	1
Brookings, US	1
DOI/NPS, Mount Rainier National Parklocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1

37 institutions · 461 of 462 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Arabis eschscholtziana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

In niches of cliffs above beach at shoreline.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 11.0–11.0

Seasonal swing summer↔winter17.0 °C

Max temp (day)16.4 °C

Min temp (night)6.20 °C

Precipitation145 mm/mo

Air humidity63.2 %

Moisture balance43.7 mm/mo

Vapour deficit486 Pa

Wind speed2.80 m/s

Cloud cover40.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)