Arabis alpina
speciesAt a glance
Occurrence records42 683
Data sources12
Biological traits38
DNA specimens61
eDNA detections30
Sources12 archives
Databases and archives Arabis alpina's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility42 683 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics61 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Chemical compositionLOTUS1 compounds
Occurrence & distributionGBIF42 683 records
Environmental DNA1 datasets · 10 countries30 detections
DNA & barcodingBOLD · NCBI61 specimens
Genome at a glanceCCDB · GoaT · NCBI381 Mbp
01Narrative
Arabis alpina est une espèce de plantes à fleurs de la famille des Brassicaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology9
Leaf size83.05 mm²
Plant height0.106 m
⚠ sources differ — GIFT: 0.106 m · LEDA: 0.138 m · TRY: 0.04 m
Plant height generative0.06 m
Plant height max0.4 m
Plant height min0.05 m
Seed length1.38 mm
Seed mass0.246 mg
⚠ sources differ — TRY: 0.246 mg · LEDA: 0.163 mg · GIFT: 0.248 mg
Seed mass max0.4 mg
Seed mass min0.24 mg
Life cycle & reproduction11
Deciduousnessevergreen
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flowering endAug
Flowering startApr
Life formsubshrub
Life spanannual
⚠ sources differ — TRY: annual · GIFT: perennial
Lifespan years4 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, mountains, sand, tundra
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio13.14 g/g
Leaf c414 mg/g
Leaf dry-matter content (LDMC)142 mg/g
Leaf n30.21 mg/g
Leaf p2.53 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)21.68 mm²/mg
⚠ sources differ — TRY: 21.68 mm²/mg · LEDA: 26.32 mm²/mg · GIFT: 26.32 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition1 compounds
Compounds documented for Arabis alpina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Documented compounds1 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 1-isothiocyanato-9-[(S)-methylsulfinyl]nonane | present | LOTUS |
05DNA & barcoding61 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arabis alpina has left across the world's sequence archives.
At a glance
DNA specimens61
Marker genes7
GenBank sequences10
eDNA detections30
Countries11
The DNA barcodea real sequence read deposited for this species
AAGTGTTGGATTCAAAGCTGGTGTTAAAGAATATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGC …
Arabis alpina voucher NMW7323 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK5★rbcL5★rbcLa★ITS★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Arabis alpina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size381 420 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Arabis alpina0.38 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–322n range16median16mode95records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1690×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +20
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Chromosome studies in some flowering plants collected in the French Alps (haute Savoie).. Rev. Gn. Bot. , 77: 487-497.
CCDB · ita-fl — BURDET H.M. - 1967. Contribution l'tude caryologique des genres Cardaminopsis, Turritis et Arabis in Europe.. Candollea , 22(1): 107-156.
CCDB · ita-fl — Baltisberger M., Widmer A. - 2011. In: IAPT/IOPB Chromosome data 11. Taxon , 60(4): 1220, E2-E3.
CCDB · ita-fl — CONTANDRIOPOULOS J., GAMISANS J. - 1974. A propos de l'element arctico-alpin de la flore corse. Bull. Soc. Bot. France , 121(5-6): 175-204.
CCDB · slov-fl — Uhríková A. & Králik E., 2000: Karyologické štúdium slovenskej flóry XXIX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 17-22.
CCDB · slov-fl — Uhríková A. & Bernátová D., 2000: Karyologické štúdium slovenskej flóry XXXII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 31-36.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Baksay L., 1957b: The chromosome numbers and cytotaxonomical relations of some European plant species. - Ann. Hist.-Nat. Mus. Natl. Hung. Series nova 8: 169-174.
CCDB · slov-fl — Kochjarová J., 1992: Karyological study of the Slovak flora XXVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 67-74.
CCDB · iapt — IAPT/IOPB Chromosome Data 11
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2314
CCDB · fl-europaea — Jones, 1963
CCDB · poland — Skali?ska M., Pogan E. et al. 1966. Further studies in chromosome numbers of Polish Angiosperms. Sixth contribution. Acta Biol. Cracov. Ser. Bot. 9, 31-58.
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Baden, C. 1983. Chromosome numbers in some Greek angiosperms. Willdenowia 13: 335–336.
CCDB · ipcn-api-dl — Strid, A. & I. A. Andersson. 1985. Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203–228.
CCDB · ipcn-api-dl — Koch, M., J. Bishop & T. Mitchell-Olds. 1999. Molecular systematics and evolution of Arabidopsis and Arabis. Pl. Biol. (Stuttgart) 1: 529–537.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Jonsell, B. 1976. Some tropical African Cruciferae. Chromosome numbers and taxonomic comments. Bot. Not. 129: 123–130.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · book-ipcn66 — Skalinska et al. 1966
CCDB · book-ipcn67-71 — TITZ, w. 1968. Chromosomenzahlen europ~ischer Arabis-Arten (Cruciferael. Ber. Deutsch. Bot. Ges. 81: 217-~
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Chromosome studies in some flowering plants collected in the French Alps (Hante Savoie). Rev. Gen. Bot. 77: 487-497.
CCDB · book-ipcn67-71 — BURDET, H.M. 1967. Contribution a l'etude caryologique des genres Cardaminopsis, Turritis et Arabis en Europe. Candollea 22: 107-156.
CCDB · book-ipcn75-78 — Hindakova 1978
CCDB · book-northern-plants — Bacher 1938 a.
CCDB · book-ipcn73-74 — CONTANDRIOPOULOS, J., & J. GAMISANS. 1974. A propos de l'element arctico-alpin de la f.lore corse. Bull. Soc. Bot. France 121: 175-204.
CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I
CCDB · book-indian_vol1 — Jaretzky, R. 1928a; Sakai, K. 1935a; Bocher, T.W. 1938a; Rollins, R.C. 1941; Bocher, T.W. & Larsen, K. 1950; Love, A. & Love, D. 1956b ; Baksay, L. 1957b ; Jorgensen, C.A. et al. 1958; Sokolovskaya, A.P. & Strelkova, O.S. 1960 ; Mulligan, G.A. 1964 ; SkaliJlska, M. (Skalinska, M. et al. 1966) ; Burdet, H.M. 1967 ; Sharma, A. & Sarkar, A.K. 1967-1968; Titz, W. 1968 ; Chaudhuri, R.K. et al. 1969 ; Delay, J. 1970a; Gade!Ia, T.W.J. & Kliphuis, E. 1970b ; Contandriopoulos, J. & Gamisans, J. 1974; Jonsell, B. 1976; Hedberg, I. & Hedberg, O. 1977
CCDB · eflora
CCDB · book-fedorov — Bakliay 1957b
CCDB · book-fedorov — Jorgensen et al. 1958
CCDB · book-fedorov — CoKonoucKaR, CTpeHROBa 1960, 1962
CCDB · book-fedorov — Hedberg O. 1962b
CCDB · book-fedorov — Mullian 1964
CCDB · book-fedorov — Skalinska (SkaliJiska et al. 1966)
CCDB · book-fedorov — Burdet 1967
CCDB · brass — Tischler
+33 more references
2n 324×CCDB · ita-fl · CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · ita-fl — BURDET H.M. - 1967. Contribution l'tude caryologique des genres Cardaminopsis, Turritis et Arabis in Europe.. Candollea , 22(1): 107-156.
CCDB · fl-europaea — Mattick, 1950
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
2n 171×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Titz, W. (1966b). Zur cytologie un Systematik einiger österreichischer Arabis-Arten (einschlieBlich Turritis glabra L.) Ber. Deutsch. Bot. Ges. 79(10):474-488.
2n 201×CCDB · Cave1963
CCDB · Cave1963 — Sokol. & Strel. 1962
n 816×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +2
CCDB · ipcn-api-dl — Dalgaard, V. 1988. Chromosome numbers in some vascular plants from the Disko Bugt area (west Greenland). Willdenowia 18: 243–252.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — DELAY, J. 1970. Orophytes. Inf. Ann. Caryosyst. et Cytogenet. 4: 1-16.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · brass — Tischler
CCDB · brass — Delay
CCDB · brass — Bcher
CCDB · brass — Dalgaard
CCDB · brass — Jaretzky
CCDB · brass — Sharma
CCDB · CromoCat 2015 — Dalgaard, V. (1988). Chromosome numbers in some vascular plants from the Disko Bugt area (west Greenland) Willdenowia 18: 243-252.
CCDB · CromoCat 2015 — Delay, J. (1970a). Orophytes. Inf. Ann. Caryosyst. et Cytogenet. 4: 1-16.
CCDB · CromoCat 2015 — Sharma, A. K. (1970). Annual report, 1967-1968 Res. Bull. Univ. Calcutta (Cytogenetics Lab.) 2: 1-50
CCDB · CromoCat 2015 — Titz, W. (1966b). Zur cytologie un Systematik einiger österreichischer Arabis-Arten (einschlieBlich Turritis glabra L.) Ber. Deutsch. Bot. Ges. 79(10):474-488.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97.4% BUSCO
08Occurrence & distribution
Record type42 683 records
Wild obs. + sensor33 898
Museum / vouchered7 961
Cultivated / captive185
Other639
Origin
Native25
Introduced15
Range
Area of Occupancy AOO52 704 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy33% within 1 km
≤100 m 6 097≤1 km 2 798≤10 km 17 363>10 km 720
26 978 georeferenced · 6 920 without coordinates
Open the mapobservation + sensor33 898
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 317≤1 km 989≤10 km 1 421>10 km 402
3 129 georeferenced · 4 832 without coordinates
Open the institutions mapphysical evidence7 961
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 6
6 georeferenced · 179 without coordinates
Open the mapnot free-living185
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions86 of 167 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 2 808 |
| Zürich, CH | 519 |
| Zürich, CH | 402 |
| Trondheim, NO | 284 |
| TROMlocation not on record | 271 |
| LDlocation not on record | 269 |
| Salzburg, AT | 253 |
| Helsinki, FI | 171 |
| Garðabær, IS | 158 |
| Uniwersytet Wrocławskilocation not on record | 158 |
| Uppsala, SE | 152 |
| MAlocation not on record | 114 |
| Oulu, FI | 94 |
| Bergen, NO | 94 |
| Oskarshamn, SE | 94 |
| Moscow State Universitylocation not on record | 92 |
| BRNUlocation not on record | 92 |
| BFLlocation not on record | 91 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 82 |
| Chengdu, CN | 80 |
| Québec, CA | 71 |
| 64 | |
| Adam Mickiewicz University in Poznańlocation not on record | 59 |
| Wlocation not on record | 53 |
| Turku, FI | 53 |
| Vitoria, ES | 51 |
| Barcelona, ES | 50 |
| Entomological Society of Latvialocation not on record | 50 |
| Kuopio, FI | 44 |
| València, ES | 42 |
| San Sebastián, ES | 42 |
| BDBClocation not on record | 41 |
| KMNlocation not on record | 39 |
| Berlin, DE | 30 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 28 |
| Bern, CH | 27 |
| Saint Louis, US | 27 |
| Provincia di Livornolocation not on record | 26 |
| BClocation not on record | 25 |
| GJOlocation not on record | 24 |
| Porrentruy, CH | 22 |
| Université Lavallocation not on record | 21 |
| Kew, GB | 21 |
| Salamanca, ES | 19 |
| Acadia Universitylocation not on record | 18 |
| Montréal, CA | 17 |
| Vancouver, CA | 16 |
| South Kensington, GB | 16 |
| MeiseBGlocation not on record | 16 |
| Chongqing Museumlocation not on record | 16 |
| SLU Artdatabankenlocation not on record | 15 |
| Montréal, CA | 15 |
| BIO-UNIPIlocation not on record | 15 |
| Bronx, US | 14 |
| College of the Atlantic, Museumlocation not on record | 14 |
| University of Stellenboschlocation not on record | 13 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 13 |
| GZUlocation not on record | 13 |
| Uniwersytet Jagiellońskilocation not on record | 13 |
| TUR-Alocation not on record | 13 |
| Frankfurt am Main | 12 |
| SZUlocation not on record | 12 |
| nbflocation not on record | 11 |
| Granada, ES | 11 |
| Edinburgh, GB | 11 |
| Görlitz, DE | 11 |
| Taipei, TW | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Madrid, ES | 8 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 8 |
| CJBGlocation not on record | 7 |
| Santiago de Compostela, ES | 7 |
| Pamplona, ES | 7 |
| Porvoo, FI | 6 |
| Mlocation not on record | 6 |
| OLAlocation not on record | 6 |
| Paris, FR | 6 |
| Pamplona, ES | 6 |
| Tromso University Museumlocation not on record | 5 |
| Tilburg, NL | 5 |
| NMBU:MINAlocation not on record | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Jyväskylä, FI | 5 |
| Stockholm, SE | 5 |
| Rovaniemi, FI | 4 |
| Canadian Museum of Naturelocation not on record | 4 |
| Wuzhou, CN | 4 |
| Copenhagen, DK | 4 |
| Karlsruhe, DE | 3 |
| CICYTEXlocation not on record | 3 |
| Corvallis, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Jaén, ES | 3 |
| Victoria, CA | 3 |
| Dresden, DE | 3 |
| Claremont, US | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Tartu, EE | 3 |
| Göteborg, SE | 3 |
| Alicante, ES | 3 |
| Sevilla, ES | 3 |
| Denver, US | 3 |
| EEZA-CSIClocation not on record | 3 |
| PRClocation not on record | 3 |
| Bloomington, US | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| WINlocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| BG-NMNHSlocation not on record | 2 |
| University of Manitoba Herbariumlocation not on record | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| National Museums of Kenyalocation not on record | 2 |
| Xiamen, CN | 2 |
| Sant Julià de Lòria, AD | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Rishon Le Zion, IL | 2 |
| Wellington, NZ | 2 |
| Provo, US | 2 |
| Herb. BBGlocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Salvador, BR | 2 |
| Pullman, US | 2 |
| Beijing, CN | 2 |
| Gijón, ES | 1 |
| San Francisco, US | 1 |
| Auckland, NZ | 1 |
| Shanghai, CN | 1 |
| Bourges, FR | 1 |
| Miami, US | 1 |
| I.N.T.A., E.E.A. Barilochelocation not on record | 1 |
| Whitehorse, CA | 1 |
| Glarus, CH | 1 |
| Burlington, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| RABATlocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Arequipa, PE | 1 |
| Fribourg, CH | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Toronto, CA | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| WTUlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Taipei, TW | 1 |
| Dekalb, US | 1 |
| Sion, CH | 1 |
| Shanxi Universitylocation not on record | 1 |
| Research Collection of Gergely Varkonyilocation not on record | 1 |
| National Natural History Collectionslocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| WAGlocation not on record | 1 |
| Bangkok, TH | 1 |
| Corrientes, AR | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| Wuhan, CN | 1 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| GINRlocation not on record | 1 |
| University of New Hampshirelocation not on record | 1 |
| Macomb, US | 1 |
| DSMlocation not on record | 1 |
167 institutions · 7 778 of 7 961 vouchered records shown · 180 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA30 detections
Where the DNA of Arabis alpina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found30
Studies independent surveys1
Countries10
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 30 detections have coordinates
Open the map10 countries0
Grown from seed
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.90 °C 2.90–14.6
Seasonal swing summer↔winter18.1 °C
Max temp (day)11.0 °C 4.30–18.1
Min temp (night)6.30 °C 0.6–11.6
Precipitation87.5 mm/mo 47.1–141
Air humidity65.0 % 58.1–69.3
Moisture balance12.2 mm/mo -51.2–54.0
Vapour deficit364 Pa 273–749
Wind speed4.00 m/s 2.10–6.00
Cloud cover51.4 % 38.1–66.0
CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.