Arabis allionii

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Arabis

At a glance

Occurrence records89

Data sources9

Biological traits19

DNA specimens4

eDNA detections3

Sources9 archives

Databases and archives Arabis allionii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF89 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Гусимець судетський — вид квіткових рослин родини капустяних (Brassicaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.35 m

Plant height max0.4 m

Plant height min0.2 m

Seed mass1.35 mg

Seed mass max1.35 mg

Seed mass min1.35 mg

Life cycle & reproduction5

Flowering endJul

Flowering startJun

Life formperennial

Life spanbiennial/perennial

⚠ sources differ — TRY: biennial/perennial · GIFT: perennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition2 compounds

Compounds documented for Arabis allionii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Glucosinolates1

Flavonols1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3-[(2R,3S,4R,5R)-3,5-dihydroxy-4-[(2R,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-7-hydroxy-2-(4-hydroxy-3-methoxyphenyl)chromen-4-one		present	LOTUS
4-Oxopentyl glucosinolate		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arabis allionii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences4

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC412259.1 ↗611 bpItaly

ACGT

TCGATCCTGTCCAAAACAGAACAACCCGCGAACAAATGATCATCACTCTCGGTTGGCCGGTTTCTTGACCGATCCTGCGCCTGCCGATTC …

Arabis allionii isolate RK065 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arabis allionii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–322n range16median16mode23records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1617×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1

CCDB · ipcn-api-dl — Andreev, V. N. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 575–576.

CCDB · ipcn-api-dl — Ancev, M. & V. Goranova. 1999. Mediterranean chromosome number reports 9 (1031--1049). Fl. Medit. 9: 331–339.

CCDB · book-ipcn67-71 — CZAPIK, R.' & I. NOVOTNA. 1968. Cyto-taxonomical and genetic problems of the Arabis hirsuta (L.) scop. complex. I. Acta Biol. Cracov:-;-sBr. Bot. 10: 167-184.

CCDB · book-ipcn67-71 — TITZ, w. 1968. Zur Cytotaxonomie von Arabis hirsuta agg. (Cruciferael. I. Allgemeine Grundlagen und die Chromosomenzahlen der in osterreich vorkommenden Sippen. Oesterr. Bot. z. 115: 225-290

CCDB · book-ipcn67-71 — BURDET, H.M. 1967. Contribution a l'etude caryologique des genres Cardaminopsis, Turritis et Arabis en Europe. Candollea 22: 107-156.

CCDB · book-ipcn67-71 — MESICEK, J. 1967. In IOPB chromosome number reports XII. Taxon 16: 341-350.

CCDB · book-ipcn75-78 — Gustavsson 1978b

CCDB · book-ipcn75-78 — 32

CCDB · brass — Titz

CCDB · brass — Andreev

CCDB · brass — Czapik & Novotn

CCDB · brass — Gustavsson

CCDB · brass — Burdet

CCDB · brass — Ancev & Goranova

CCDB · brass — Mescek

2n 326×CCDB · ita-fl · CCDB · book-ipcn67-71 · CCDB · brass

CCDB · ita-fl — BURDET H.M. - 1967. Contribution l'tude caryologique des genres Cardaminopsis, Turritis et Arabis in Europe.. Candollea , 22(1): 107-156.

CCDB · book-ipcn67-71 — BURDET, H.M. 1967. Contribution a l'etude caryologique des genres Cardaminopsis, Turritis et Arabis en Europe. Candollea 22: 107-156.

CCDB · brass — Burdet

CCDB · brass — Titz

2n 1951×CCDB · book-fedorov

CCDB · book-fedorov — Gb

n 82×CCDB · book-ipcn67-71 · CCDB · brass

CCDB · book-ipcn67-71 — CZAPIK, R.' & I. NOVOTNA. 1968. Cyto-taxonomical and genetic problems of the Arabis hirsuta (L.) scop. complex. I. Acta Biol. Cracov:-;-sBr. Bot. 10: 167-184.

CCDB · brass — Czapik & Novotn

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type89 records

Wild obs. + sensor67

Museum / vouchered22

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 3≤1 km 10≤10 km 44>10 km 4

61 georeferenced · 6 without coordinates

Open the mapobservation + sensor67

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 4≤10 km 2

6 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	4
GJOlocation not on record	4
Oulu, FI	2
BIO-UNIPIlocation not on record	2
Barcelona, ES	1
Görlitz, DE	1
Zürich, CH	1
BClocation not on record	1
Conservatoire botanique national du Bassin parisienlocation not on record	1

9 institutions · 17 of 22 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Arabis allionii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C -1.30–12.7

Seasonal swing summer↔winter20.0 °C

Max temp (day)9.80 °C 2.60–17.0

Min temp (night)0.5 °C -6.50–7.60

Precipitation88.1 mm/mo 75.4–101

Air humidity56.7 % 55.4–57.9

Moisture balance7.20 mm/mo -15.1–29.5

Vapour deficit513 Pa 298–728

Wind speed5.30 m/s 3.10–7.50

Cloud cover42.4 % 41.2–43.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)