Arabidella trisecta

(F.Muell.) O.E.Schulz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Arabidella

At a glance

Occurrence records1 143

Data sources8

Biological traits33

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Arabidella trisecta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF1 143 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Arabidella trisecta là một loài thực vật có hoa trong họ Cải. Loài này được (F.Muell.) O.E.Schulz mô tả khoa học đầu tiên năm 1924.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length25 mm

Fruit width1 mm

Leaf length40 mm

Leaf length max40 mm

Leaf mass3.56 mg

Leaf mass per area89.0 g/m2

Leaf size46.64 mm²

Leaf width1.93 mm

Plant height0.6 m

Plant height max0.6 m

Plant height min0.15 m

Seed length0.85 mm

Seed mass0.093 mg

Life cycle & reproduction7

Dispersal typeself

Flowering timennnnyyyyyynn

Life formsubshrub or shrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typesilique

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arabidella trisecta has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSOL339493.1 ↗7 296 bp

ACGT

TGTACCCTTGTGGCCTAGGTTGATGGGCGTGCTTCGATGGAAAGCATGGATGCACCTAGGCCGTCCCGTGGGTGAGCAAGGTGGCGGTGT …

Arabidella trisecta voucher N. Scarlett 2010 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL6★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arabidella trisecta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 122×CCDB · book-ipcn67-71 · CCDB · brass

CCDB · book-ipcn67-71 — ROLLINS, R.C.' L. RUEDENBERG. 1971. Chromosome numbers of Cruciferae. II. Contr. Gray Herb. No. 201: 117-133.

CCDB · brass — Rollins & Rdenberg

n 181×CCDB · brass

CCDB · brass — Montruccoli

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 143 records

Wild obs. + sensor344

Museum / vouchered793

Other6

Origin

Native258

Range

Area of Occupancy AOO3 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 175≤1 km 24≤10 km 62>10 km 7

268 georeferenced · 76 without coordinates

Open the mapobservation + sensor344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 88≤1 km 116≤10 km 374>10 km 136

714 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence793

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	439
Museo Entomologico de Leonlocation not on record	80
Canberra, AU	77
Mount Annan, AU	42
Kensington, AU	30
Palmerston, AU	28
Brisbane, AU	26
Armidale, AU	12
Hobart, AU	5
John T. Waterhouse Herbariumlocation not on record	5
EL PASO, US	3
Parkville, AU	3
University of Stellenboschlocation not on record	2
Kew, GB	2
MeiseBGlocation not on record	1
BGPAlocation not on record	1
Beijing, CN	1
Claremont, US	1

18 institutions · 758 of 793 vouchered records shown · 35 without an institution code

09Environmental DNA2 detections

Where the DNA of Arabidella trisecta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arabidella trisecta

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction7

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 143 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 143 records