Aquita plagiochyta

Turner, 1944 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nolidae/Aquita

At a glance

Occurrence records97

Data sources6

Biological traits0

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Aquita plagiochyta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility97 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF97 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Aquita plagiochyta is een vlinder uit de familie van de visstaartjes (Nolidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1944 door Turner.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquita plagiochyta has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P164 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 1 variable positions, in barcode order

56Avariable

TAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAACA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type97 records

Wild obs. + sensor89

Museum / vouchered8

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 80≤10 km 3>10 km 1

84 georeferenced · 5 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	5
Australian National Insect Collectionlocation not on record	2
Natick, US	1

3 institutions · 8 of 8 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Aquita plagiochyta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 15.1–18.5

Seasonal swing summer↔winter11.8 °C

Max temp (day)20.0 °C 19.2–23.3

Min temp (night)12.6 °C 11.1–14.2

Precipitation95.6 mm/mo 87.6–140

Air humidity61.5 % 60.6–62.0

Moisture balance18.7 mm/mo 11.9–21.5

Vapour deficit724 Pa 664–811

Wind speed2.30 m/s 2.00–2.50

Cloud cover21.7 % 21.6–29.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)