Aquilegia vulgaris

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records178 699

Data sources12

Biological traits59

DNA specimens52

eDNA detections55

Sources12 archives

Databases and archives Aquilegia vulgaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility178 699 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources59 traits

Chemical compositionNPASS17 compounds

Occurrence & distributionGBIF178 699 records

Environmental DNA2 datasets · 5 countries55 detections

DNA & barcodingBOLD · NCBI52 specimens

Genome at a glanceCCDB · GoaT · NCBI401 Mbp

01Narrative

L'ancolie commune (Aquilegia vulgaris), appelée aussi aiglantine, ancolie des jardins, cornette ou encore colombine, bonne-femme, bonnets de grand-mère et cinq-doigts, est une espèce de plante à fleurs de la famille des Ranunculaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsLEDATRYWCVP

Size & morphology17

Fruit length22.5 mm

Fruit length max35 mm

Fruit length min18 mm

Leaf length50 mm

Leaf mass142 mg

Leaf size9 402 mm²

Petiole length40 cm

Plant height0.625 m

⚠ sources differ — GIFT: 0.625 m · AusTraits: 0.7 m · LEDA: 0.55 m · TRY: 0.4 m

Plant height generative0.7 m

Plant height max1 m

Plant height min0.3 m

Seed length2.41 mm

⚠ sources differ — TRY: 2.41 mm · AusTraits: 2.25 mm · GIFT: 2.3 mm

Seed length max2.3 mm

Seed length min2.3 mm

Seed mass1.42 mg

⚠ sources differ — TRY: 1.42 mg · LEDA: 1.65 mg · GIFT: 1.54 mg

Seed mass max1.75 mg

Seed mass min0.78 mg

Life cycle & reproduction20

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dehiscencedehiscent

Dispersal typehuman

⚠ sources differ — LEDA: ethelochor · GIFT: unspecialized

Flower colourblue

Flower length max13 mm

Flower length min9 mm

Flower width max11 mm

Flower width min8 mm

Flowering endJul

Flowering startMay

Life formperennial

Life spanperennial

⚠ sources differ — TRY: perennial · AusTraits: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial

Lifespan years10 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Seed number302

Self fertilizationpresent

Sex typehermaphrodite

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit typefollicle

⚠ sources differ — AusTraits: follicle · GIFT: capsule

Growth formherb

Habitat GIFTforest,meadows,parks

Leaf compoundnesscompound

Leaf shapeobtriangular widely_ovate

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry5

Leaf dry-matter content (LDMC)269 mg/g

⚠ sources differ — TRY: 269 mg/g · LEDA: 295 mg/g

Leaf n26.58 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)33.11 mm²/mg

⚠ sources differ — TRY: 33.11 mm²/mg · LEDA: 26.01 mm²/mg · GIFT: 26.01 mm²/mg

Other traits2

Diaspore typeone-seeded generative dispersule

Seeds per fruit>1000

03Chemical composition17 compounds

Compounds documented for Aquilegia vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pyrrolidine alkaloids2

Piperidine alkaloids2

Cycloartane triterpenoids1

Simple phenolic acids1

Dicarboxylic acids1

Documented compounds17 total

Compound	Amount	Source
3,4-Pyrrolidinediol, 2-(hydroxymethyl)-5-(4-hydroxyphenyl)-, (2R,3R,4S,5S)-	present	NPASS
4-Hydroxybenzoic acid	present	NPASS
Aquilegioside B	present	NPASS
BCDXAYZABZINKR-ILELZTEMSA-N	present	NPASS
JLEIZHHBZFYFEV-HHKUDFODSA-N	present	NPASS
KHFAHPBEWUVDKE-SBMZQEIYSA-N	present	NPASS
L-Radicamine A	present	NPASS
Lobelanine	present	NPASS
LWKMTLMSNFINNF-ZMTXAMAQSA-N	present	NPASS
MEMJTKABVOIASN-LPJWICATSA-O	present	NPASS

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia vulgaris has left across the world's sequence archives.

At a glance

DNA specimens52

Marker genes5

GenBank sequences10

eDNA detections55

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMG237777.1 ↗340 bpCanada

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAGGCCTTCTGGTCGAGGGCACGTCTGCCTGGGCGTCACGCACA …

Aquilegia vulgaris voucher 18349HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcL7rbcLaITS3ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Aquilegia vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size400 980 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aquilegia vulgaris0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome records14–162n range14median14mode54records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1450×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +15

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.

CCDB · ita-fl — RAIMONDO F.M., ROSSITTO M., OTTONELLO D. - 1984 (1983). Numeri cromosomici per la flora italiana:967-976.. Inform. Bot. Ital. , 15(1): 58-65.

CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.

CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.

CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)

CCDB · brit-fl — Curran, P.L. Irish Naturalists' J. 16: 7-9 (1968)

CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1669

CCDB · fl-europaea — Skalinska, 1950

CCDB · poland — Skali?ska M., Pogan E. et al. 1966. Further studies in chromosome numbers of Polish Angiosperms. Sixth contribution. Acta Biol. Cracov. Ser. Bot. 9, 31-58.

CCDB · poland — Skali?ska M. 1950. Studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 20, nr 1949-1950.

CCDB · poland — Pra?mo W. 1960. Genetic studies on the genus Aquilegia L. I. Crosses between Aquilegia vulgaris L. and Aquilegia ecalcarala Maxim. Acta Soc. Bot. Pol. 29, 57-77.

CCDB · ipcn-api-dl — Raimondo, F. M., M. Rossitto & D. Ottonello. 1983a. Numeri cromosomici per la Flora Italiana: 983-992. Inform. Bot. Ital. 15: 180–187.

CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.

CCDB · ipcn-api-dl — Vassiljeva, I. M. 1990. Chromosome numbers in the genus Aquilegia (Ranunculaceae) of the flora of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1319.

CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.

CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.

CCDB · ipcn-api-dl — López Pacheco, M. J. 2002. Números cromosomáticos de plantas occidentales, 921--936. Anales Jard. Bot. Madrid 59(2): 287–288.

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

CCDB · book-ipcn75-78 — Hindakova 1974

CCDB · book-ipcn75-78 — Hindakova 1978

CCDB · book-northern-plants — Gregory 1941.

CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.

CCDB · book-indian_vol1 — Langlet, O.F.J. 1927a ; Skalinska, M. 1928, 1950 ; Gregory, W.C. 1941 ; Delay, C. 1947 ; Mattick (Tischler, G. 1950) ; Prazmo, W. 1960, 1965 ; Lin- nert, G. 1961 ; Sobti, S.N. & Singh, S.D. 1961 ; Curran. P.L. 1968 ; Mehra, P.N. & Remanandan, P. 1972

CCDB · eflora

CCDB · book-fedorov — KyKOBa 1961

CCDB · book-fedorov — Skalinska 1964

CCDB · book-fedorov — Langlet 1927a

CCDB · book-fedorov — Skalinska 1928, 1950a

CCDB · book-fedorov — Gregory W. C. 1941

CCDB · book-fedorov — Delay 1947

CCDB · book-fedorov — Mattick (T. 1950)

CCDB · book-fedorov — Prazmo 1960, 1965

CCDB · book-fedorov — Linnert 1961

CCDB · CromoCat 2015 — Martinell, M. C., Sáez, L. & Molero, J. (2007). Taxonomic assessment of the critically endangered narrow endemic Aquilegia paui Font Quer. Llibre de resums del XII OPTIMA Meeting

CCDB · CromoCat 2015 — Dempsey, R. E., Gornall, R. J. & Bailey, J. P. (1994). Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63-66.

CCDB · CromoCat 2015 — Lippert, W. (2006). Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten Ber. Bayer. Bot. Ges. 76: 85–110

CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974a). Cytotaxonomy of Spanish plants III. Dycotiledons: Salicaceae-Rosaceae. Lagascalia 4(1): 3-32.

+7 more references

2n 164×CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-indian_vol1 — Anderson, E. & Schafer, B. 1931

CCDB · book-fedorov — CoKoJIOBCKaH, CTpenKosa 1940, 19486, 1962

CCDB · book-fedorov — Kyxosa 1961

CCDB · book-fedorov — Anderson E., S~afer 1931

n 73×CCDB · book-ipcn65 · CCDB · CromoCat 2015

CCDB · book-ipcn65 — Prazmo 1965

CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1972). Cytology of some Himalayan Ranunculaceae. Cytologia 37: 281-296.

n 163×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · iber-fl — IOPB. Chromosome data 7 (ed. A. Stace). Diosdado, J. C. & al.Intern. Organ. Plant Biosyst.22: 3-4(1994).

CCDB · ipcn-api-dl — Diosdado, J. C., J. Vioque, R. Juan & J. Pastor. 1994. IOPB chromosome data 7. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 22: 3–4.

CCDB · CromoCat 2015 — Diosdado, J. C., Vioque, J., Juan, R. & Pastor, J. E. (1994). IOPB Chromosome Data 7 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 22: 3-4.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.4% BUSCO

08Occurrence & distribution

Record type178 699 records

Wild obs. + sensor171 543

Museum / vouchered6 068

Cultivated / captive58

Other1 030

Origin

Native2 350

Introduced107

Range

Area of Occupancy AOO293 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 47 603≤1 km 21 197≤10 km 75 834>10 km 1 214

145 848 georeferenced · 25 695 without coordinates

Open the mapobservation + sensor171 543

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 537≤1 km 940≤10 km 2 087>10 km 434

3 998 georeferenced · 2 070 without coordinates

Open the institutions mapphysical evidence6 068

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy41% within 1 km

≤1 km 9≤10 km 4>10 km 9

22 georeferenced · 36 without coordinates

Open the mapnot free-living58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions124 of 227 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	1 152
BFLlocation not on record	496
Helsinki, FI	248
LDlocation not on record	245
Olocation not on record	217
KMNlocation not on record	171
MeiseBGlocation not on record	157
SLU Artdatabankenlocation not on record	140
Trondheim, NO	129
Tartu, EE	120
Bergen, NO	119
Kuopio, FI	117
Moscow State Universitylocation not on record	115
Oskarshamn, SE	105
Salzburg, AT	97
TROMlocation not on record	81
Barcelona, ES	71
Adam Mickiewicz University in Poznańlocation not on record	64
Tallinn, EE	59
MAlocation not on record	59
No collectionlocation not on record	57
València, ES	57
GJOlocation not on record	54
Québec, CA	53
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	47
Bern, CH	45
Jyväskylä, FI	45
Museo Entomologico de Leonlocation not on record	44
Philadelphia, US	42
BDBClocation not on record	42
South Kensington, GB	37
Uppsala, SE	37
Allentown, US	35
Chongqing Museumlocation not on record	33
Acadia Universitylocation not on record	32
Görlitz, DE	32
Bronx, US	31
BIO-UNIPIlocation not on record	31
Saint John, CA	31
Oulu, FI	29
BClocation not on record	29
BRNUlocation not on record	28
Entomological Society of Latvialocation not on record	25
Tampere, FI	25
LfUlocation not on record	23
KFGBlocation not on record	23
IFR-DNFlocation not on record	22
Université Lavallocation not on record	22
Burlington, US	20
Auckland, NZ	20
CICYTEXlocation not on record	20
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	19
Wlocation not on record	18
Turku, FI	16
Provincia di Livornolocation not on record	16
DBF-NHMDlocation not on record	16
Porrentruy, CH	15
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	15
University of New Hampshirelocation not on record	15
Montréal, CA	15
Wellington, NZ	14
Uniwersytet Śląski w Katowicachlocation not on record	14
Beijing, CN	13
Tula State Universitylocation not on record	13
Mlocation not on record	12
New Haven, US	12
Madrid, ES	12
Salamanca, ES	12
Christchurch, NZ	12
CJBGlocation not on record	11
Zürich, CH	11
Karlsruhe, DE	11
College of the Atlantic, Museumlocation not on record	11
Hobart, AU	10
PRClocation not on record	10
Zürich, CH	9
Frauenfeld, CH	9
Universidad del Pais Vasco (UPV/EHU)location not on record	8
WTUlocation not on record	8
Stockholm, SE	8
Frankfurt am Main	8
Conservatoire botanique national du Bassin parisienlocation not on record	8
Porvoo, FI	8
Vitebsk State University named after P.M. Masherovlocation not on record	8
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	7
Uniwersytet Jagiellońskilocation not on record	7
Winterthur, CH	7
Canberra, AU	7
Museo della Bonifica di San Donà di Piavelocation not on record	7
Cambridge, US	6
Ann Arbor, US	6
College Park, US	6
Badajoz, ES	6
UGentlocation not on record	6
Institut und Museum fuer Geologie und Palaeontologielocation not on record	6
Pamplona, ES	6
Tampa, US	5
Uniwersytet Warszawskilocation not on record	5
National Museum Waleslocation not on record	5
Berlin, DE	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Mount Annan, AU	5
TUR-Alocation not on record	5
Podgorica, ME	5
Kostrzyca Forest Gene Banklocation not on record	5
GZUlocation not on record	5
Xining, CN	5
Jaén, ES	5
Nagano City, JP	5
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	5
Vancouver, CA	4
Wuzhou, CN	4
Chapel Hill, US	4
PrivatHerblocation not on record	4
Rotorua, NZ	4
Saint Louis, US	4
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	4
Tromso University Museumlocation not on record	4
ISAlocation not on record	3
Philadelphia, US	3
Parkville, AU	3
Keene State Universitylocation not on record	3
Sion, CH	3
NMBU:MINAlocation not on record	3
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	3
Forssa, FI	3
Madison, US	3
SZUlocation not on record	3
Davenport, US	3
Armidale, AU	3
University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record	3
Tilburg, NL	3
Xiamen, CN	2
Hudson, US	2
Columbia, US	2
Paris, FR	2
Victoria, CA	2
Norfolk, US	2
Millersville, US	2
Wuhan, CN	2
Pontificia Universidad Javeriana (PUJ)location not on record	2
Beijing Normal Universitylocation not on record	2
Rovaniemi, FI	2
Dresden, DE	2
John May Museum of Natural Historylocation not on record	2
Alicante, ES	2
Obihiro Centennial City Museumlocation not on record	2
Otaru, JP	2
nbflocation not on record	2
Salvador, BR	2
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	2
Bourges, FR	2
Johnson City, US	2
Toronto, CA	2
Bloomington, US	2
Adelaide, AU	2
Mohonk Preservelocation not on record	2
Muséum Henri Lecoqlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Philadelphia, US	2
University of Guelph, OAC Herbariumlocation not on record	2
Monastir, TN	2
Brookings, US	2
Dhaka, BD	2
Green Bay, US	2
Glarus, CH	2
H-Schuhwlocation not on record	2
Universidad de La Salle (La Salle)location not on record	2
Siouxland Heritage Museumlocation not on record	2
Granada, ES	2
Flagstaff, US	1
Sant Julià de Lòria, AD	1
Baroda, IN	1
Chiba, JP	1
Kingston, US	1
Royal Botanic Gardens, Kewlocation not on record	1
JBAlocation not on record	1
Uniwersytet w Białymstokulocation not on record	1
H-Wolflocation not on record	1
BioFokuslocation not on record	1
Fribourg, CH	1
Emporia, US	1
Turlock, US	1
Claremont, US	1
Kew, GB	1
CASlocation not on record	1
Nijmegen, NL	1
FLADlocation not on record	1
IPE-CSIClocation not on record	1
Toyama, JP	1
MHNAIXlocation not on record	1
Banyoles, ES	1
Guilin, CN	1
Stephenville, US	1
BSBIlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
Pocatello, US	1
Santa Barbara, US	1
DOI/NPS, Mount Rainier National Parklocation not on record	1
Sevilla, ES	1
Lausanne, CH	1
OLAlocation not on record	1
McWane Science Centerlocation not on record	1
Guangzhou, CN	1
ESP109location not on record	1
Orem, US	1
Pamplona, ES	1
Universite de Montreal, L'Herbier Marie-Victorinlocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Musée des Confluenceslocation not on record	1
Uniwersytet Opolskilocation not on record	1
UNINE:NEUlocation not on record	1
University of Alberta Museumslocation not on record	1
Umeå Universitylocation not on record	1
Bangkok, TH	1
Staten Island, US	1
H-Dunkellocation not on record	1
Portland, US	1
Juriquilla, MX	1
AUT001location not on record	1
Bothell, US	1
Missoula, US	1
Moscow, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Fulda, DE	1
Nanjing, CN	1

227 institutions · 5 784 of 6 068 vouchered records shown · 283 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA55 detections

Where the DNA of Aquilegia vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map5 countries0

Grown in glass house from wild MSB accession

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 11.7–16.4

Seasonal swing summer↔winter21.6 °C

Max temp (day)20.5 °C 14.4–20.7

Min temp (night)11.2 °C 8.40–12.2

Precipitation70.6 mm/mo 57.1–97.5

Air humidity59.2 % 59.0–63.0

Moisture balance-36.4 mm/mo -53.6–4.70

Vapour deficit757 Pa 511–804

Wind speed3.90 m/s 2.50–4.60

Cloud cover37.8 % 32.5–51.1

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources12 archives

Size & morphology17

Life cycle & reproduction20

Diet & foraging2

Habitat & environment13

Physiology & chemistry5

Other traits2

Compound class profile5 classes

Documented compounds17 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type178 699 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions124 of 227 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type178 699 records