Aquilegia viscosa

Gouan · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records474

Data sources8

Biological traits6

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Aquilegia viscosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility474 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources6 traits

Occurrence & distributionGBIF474 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology1

Seed mass3.08 mg

Life cycle & reproduction1

Life formperennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia viscosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSEU747246.1 ↗594 bp

ACGT

GCAGAACGACCCGCGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAGCCCCCGACCGATCCCTTCGCCGTTCCGCGGC …

Aquilegia viscosa isolate AVS19632745 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aquilegia viscosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–282n range21median14mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.

CCDB · book-fedorov — Skalinska 1964

2n 282×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Gregory W. C. 1941

CCDB · book-atlas-flowering-plants — Gregory 1941

n 71×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type474 records

Wild obs. + sensor465

Museum / vouchered8

Other1

Range

Area of Occupancy AOO384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤100 m 1≤10 km 361>10 km 22

384 georeferenced · 81 without coordinates

Open the mapobservation + sensor465

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Barcelona, ES	2
BDBClocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Wlocation not on record	1
Bourges, FR	1

5 institutions · 8 of 8 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Aquilegia viscosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)