Aquilegia thalictrifolia — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records6

Data sources6

Biological traits7

DNA specimens12

eDNA detections12

Sources6 archives

Databases and archives Aquilegia thalictrifolia's data was compiled from.

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 0 countries12 detections

DNA & barcodingBOLD · NCBI12 specimens

02Traits & measurements

SourcesTRYLEDAGIFT

Size & morphology2

Plant height0.3 m

Seed mass0.859 mg

Life cycle & reproduction2

Life spanperennial

Lifespan years5 years

Habitat & environment2

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia thalictrifolia has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes3

GenBank sequences10

eDNA detections12

The DNA barcodea real sequence read deposited for this species

rbcLPV564795.1 ↗161 549 bp

ACGT

GTATAATATAATTATAATAATTAAAATTAAATTATTATTAAGTATAATTATATTATTATAATTATATACAAATCATTATGAAATATTTAT …

Aquilegia thalictrifolia isolate P926 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK9rbcL1ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type6 records

Museum / vouchered5

Other1

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 1≤1 km 3>10 km 1

5 georeferenced

Open the institutions mapphysical evidence5

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GJOlocation not on record	2
Flagstaff, US	1
University of Alberta Museumslocation not on record	1
PRClocation not on record	1

4 institutions · 5 of 5 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Aquilegia thalictrifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.