Aquilegia sibirica

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records2 072

Data sources9

Biological traits20

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Aquilegia sibirica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 072 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF2 072 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Aquilegia sibirica est une espèce de plantes à fleurs de la famille des Renonculacées originaire d'Asie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Leaf width max100 mm

Leaf width min40 mm

Plant height0.475 m

Plant height max0.7 m

Plant height min0.2 m

Life cycle & reproduction5

Flowering endAug

Flowering startMay

Life formperennial

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation mean1 800 m

Elevation min1 600 m

Growth formherb

Habitat GIFTmeadows, mountains, stony places

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia sibirica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLK054541.1 ↗589 bpRussia

ACGT

GCAGAACGACCCGCGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAGCCCCCGACCGATCCCTCGCCGTTCCGCGGCC …

Aquilegia sibirica genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, isolate Aq3

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aquilegia sibirica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–162n range14median14mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1411×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +2

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.

CCDB · ipcn-api-dl — Vassiljeva, I. M. 1990. Chromosome numbers in the genus Aquilegia (Ranunculaceae) of the flora of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1319.

CCDB · ipcn-api-dl — Friesen, N. V. 1991. Chromosome numbers in members of the Ranunculaceae family from Siberia. Bot. Žhurn. (Moscow & Leningrad) 76: 905–907.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1981. Chromosome numbers of some species of the family Ranunculaceae II. Bot. Zhurn. 66 (12): 1751–1755.

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

CCDB · book-ipcn75-78 — Rostovtseva 1977

CCDB · book-fedorov — Kyxosa 1961

CCDB · book-fedorov — Gregory W. C. 1941

CCDB · book-fedorov — KyKOBa 1961

CCDB · iapt — IAPT/IOPB Chromosome Data 23

CCDB · iapt — IAPT/IOPB Chromosome Data 27

2n 161×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 22

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 072 records

Wild obs. + sensor1 878

Museum / vouchered190

Cultivated / captive4

Range

Area of Occupancy AOO4 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 444≤1 km 129≤10 km 562>10 km 330

1 465 georeferenced · 413 without coordinates

Open the mapobservation + sensor1 878

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 2≤1 km 15≤10 km 60>10 km 9

86 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence190

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	143
BRNUlocation not on record	10
Bronx, US	3
Durham, US	3
Beijing, CN	2
Görlitz, DE	2
Berlin, DE	2
Chengdu, CN	2
Mlocation not on record	1
Chinese Academy of Forestrylocation not on record	1
Lanzhou, CN	1
CASlocation not on record	1
Tampa, US	1
Denver, US	1
Corvallis, US	1
Saint Louis, US	1
Guangzhou, CN	1
WNNUlocation not on record	1
Vitebsk State University named after P.M. Masherovlocation not on record	1
Edinburgh, GB	1
IWEP FEB RASlocation not on record	1

21 institutions · 180 of 190 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Aquilegia sibirica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aquilegia sibirica

At a glance

Sources9 archives

Size & morphology5

Life cycle & reproduction5

Diet & foraging1

Habitat & environment9

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 072 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 072 records