Aquilegia saximontana

Rydb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records178

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Aquilegia saximontana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility178 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF178 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

01Narrative

Aquilegia saximontana, the Rocky Mountain columbine, alpine dwarf columbine, dwarf blue columbine, or alpine columbine, is a perennial plant that comes from the buttercup family, Ranunculaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia saximontana has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSPQ144387.1 ↗608 bp

ACGT

TCGAAACCTGCTCAAGCAGAACGACCCGCGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAGCCCCCGACCGATCCCT …

Aquilegia saximontana voucher Roh MS 20041807 (NS) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aquilegia saximontana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type178 records

Wild obs. + sensor118

Museum / vouchered60

Range

Area of Occupancy AOO408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 67≤1 km 6≤10 km 2>10 km 20

95 georeferenced · 23 without coordinates

Open the mapobservation + sensor118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤1 km 29≤10 km 8

37 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	23
Denver, US	14
Bronx, US	9
Musee des Dinosaures d'Esperaza (Aude)location not on record	4
DOI/NPS, Greenbelt Parklocation not on record	3
Pocatello, US	2
Wuzhou, CN	2
Rocky Mountain Biological Laboratorylocation not on record	1
Bloomington, US	1
Durango, US	1

10 institutions · 60 of 60 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)