Aquilegia pyrenaica

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records2 169

Data sources6

Biological traits6

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Aquilegia pyrenaica's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 169 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF2 169 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Plant height0.03 m

Life cycle & reproduction1

Life formperennial

Habitat & environment2

Climatetemperate

Growth formherb

Physiology & chemistry2

Leaf n31.11 mg/g

Specific leaf area (SLA)28.33 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia pyrenaica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSEU747258.1 ↗594 bp

ACGT

GCAGAACGACCCGCGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAGCCCCCGACCGATCCCTTCGCCGTTCCGCGGC …

Aquilegia pyrenaica isolate AP14JB04 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 169 records

Wild obs. + sensor2 045

Museum / vouchered114

Cultivated / captive1

Other9

Origin

Introduced15

Range

Area of Occupancy AOO2 728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 187≤1 km 114≤10 km 1 112>10 km 54

1 467 georeferenced · 578 without coordinates

Open the mapobservation + sensor2 045

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 4≤1 km 21≤10 km 21

46 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence114

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	24
Barcelona, ES	20
Vitoria, ES	18
MAlocation not on record	10
Universidad del Pais Vasco (UPV/EHU)location not on record	7
BClocation not on record	6
Jaén, ES	4
Entomological Society of Latvialocation not on record	3
Paris, FR	2
Salamanca, ES	2
Wlocation not on record	2
Museo Achille Folettolocation not on record	2
Badajoz, ES	2
Pamplona, ES	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Monastir, TN	2
Gijón, ES	1
Zürich, CH	1
Salvador, BR	1
CICYTEXlocation not on record	1
OLAlocation not on record	1

21 institutions · 113 of 114 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Aquilegia pyrenaica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aquilegia pyrenaica

At a glance

Sources6 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Physiology & chemistry2

At a glance

Record type2 169 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 169 records