Aquilegia moorcroftiana

Wall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records6

Data sources9

Biological traits19

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Aquilegia moorcroftiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

腺毛耧斗菜（学名：）为毛茛科耧斗菜属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length20 mm

Fruit length max24 mm

Fruit length min16 mm

Leaf length17.5 mm

Leaf length max20 mm

Leaf length min15 mm

Plant height0.3 m

Plant height max0.4 m

Plant height min0.2 m

Seed mass0.81 mg

Life cycle & reproduction1

Life formperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max4 200 m

Elevation mean3 700 m

Elevation min1 600 m

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Aquilegia moorcroftiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Cycloartane triterpenoids4

Carboline alkaloids1

Lupane triterpenoids1

Stilbenolignans1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3aS,4R,8bS)-1-(3,4-dihydroxyphenyl)-4-(4-hydroxy-3,5-dimethoxyphenyl)-3,3a,4,8b-tetrahydro-1H-indeno[1,2-c]furan-5,7-diol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-2-[[(1S,4R,5R,6R,8R,10S,12S,13S,16R,18S,21R)-10-methoxy-4,6,12,17,17-pentamethyl-8-[(Z)-2-methyl-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyprop-1-enyl]-9-oxahexacyclo[11.9.0.01,21.04,12.05,10.016,21]docosan-18-yl]oxy]-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-[[(1S,4R,5R,6R,8R,10S,12S,13S,16R,18S,21R)-10-methoxy-4,6,12,17,17-pentamethyl-8-[(Z)-2-methyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyprop-1-enyl]-9-oxahexacyclo[11.9.0.01,21.04,12.05,10.016,21]docosan-18-yl]oxy]oxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
1-(2,4-Dimethoxyphenyl)-3-(4-Hydroxyphenyl)Prop-2-En-1-One	present	NPASS
2-[4,5-Dihydroxy-6-(hydroxymethyl)-2-[[10-methoxy-4,6,12,17,17-pentamethyl-8-[2-methyl-3-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyprop-1-enyl]-9-oxahexacyclo[11.9.0.01,21.04,12.05,10.016,21]docosan-18-yl]oxy]oxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
2-[5-Hydroxy-6-(hydroxymethyl)-2-[[10-methoxy-4,6,12,17,17-pentamethyl-8-[2-methyl-3-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyprop-1-enyl]-9-oxahexacyclo[11.9.0.01,21.04,12.05,10.016,21]docosan-18-yl]oxy]-4-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
Betulinic Acid	present	NPASS
Vincosamide	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia moorcroftiana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLPV564778.1 ↗161 995 bp

ACGT

AATATATAATTATATTTATAATATAATAATTATTATATTATAAAGTATAATTATAATATTATAATTATATACAAATCATTATGAAATATT …

Aquilegia moorcroftiana isolate P912 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type6 records

Wild obs. + sensor1

Museum / vouchered4

Cultivated / captive1

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	4

1 institutions · 4 of 4 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Aquilegia moorcroftiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)