Aquilegia magellensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records6

Data sources6

Biological traits3

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Aquilegia magellensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Aquilegia magellensis là một loài thực vật có hoa trong họ Mao lương. Loài này được F.Conti & Soldano mô tả khoa học đầu tiên năm 2005.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass0.866 mg

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatetemperate

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia magellensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPV564777.1 ↗161 328 bp

ACGT

GTATAATATAATTATAATAATTATTATAAAGTATAATTATATTATAATAATTATATACAAATTACAAATCATTATGAAATATTTATTCGA …

Aquilegia magellensis isolate P923 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1

plant barcode

08Occurrence & distribution

Record type6 records

Wild obs. + sensor3

Museum / vouchered3

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3

1 institutions · 3 of 3 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aquilegia magellensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.