Aquilegia lucensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records199

Data sources4

Biological traits3

DNA specimens1

eDNA detections0

Sources4 archives

Databases and archives Aquilegia lucensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility199 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF199 records

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass2.33 mg

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatetemperate

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia lucensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ144432.1 ↗607 bp

ACGT

TCGAAACCTGCTCAAGCAGAACGACCCGCGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAGCCCCCGACGATCCCTT …

Aquilegia lucensis voucher Foggi B s.n. (FI) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL3ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type199 records

Wild obs. + sensor33

Museum / vouchered166

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 5≤1 km 3>10 km 1

9 georeferenced · 24 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 166 records without

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
BIO-UNIPIlocation not on record	166

1 institutions · 166 of 166 vouchered records shown