Aquilegia glandulosa

Fisch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records740

Data sources9

Biological traits24

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Aquilegia glandulosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility740 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources24 traits

Occurrence & distributionGBIF740 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Aquilegia glandulosa est une espèce de plantes à fleurs de la famille des Renonculacées, originaire d'Asie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology9

Fruit length25 mm

Fruit length max30 mm

Fruit length min20 mm

Leaf length22.5 mm

Leaf length max30 mm

Leaf length min15 mm

Plant height0.3 m

Plant height max0.6 m

Plant height min0.12 m

Life cycle & reproduction5

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 700 m

Elevation mean2 300 m

Elevation min1 900 m

Growth formherb

Habitat GIFTmeadows, mountains, rivers, stony places

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia glandulosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLK054536.1 ↗594 bpRussia

ACGT

GCAGAACGACCCGCGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAGCCCCCGACCGATCCCTTCGCCGTTCCGCGGC …

Aquilegia glandulosa genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, isolate Aq1

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aquilegia glandulosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–182n range14median14mode21records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1417×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol1 +2

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.

CCDB · ipcn-api-dl — Krasnoborov, I. M., N. S. Krukova & V. V. Rubtsova. 1968. Nekotorye dekorativnye rastenija Zapadnogo Sajana i ikh khromosomnyj sostav. Introdukcija Dekorat. Rastenij dla Cvetnikov i Gazonov Sibiri. Novosibirsk. 1968: 30–34.

CCDB · ipcn-api-dl — Vassiljeva, I. M. 1990. Chromosome numbers in the genus Aquilegia (Ranunculaceae) of the flora of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1319.

CCDB · book-ipcn75-78 — Krogulevich 1976

CCDB · book-ipcn75-78 — Krogulevich 1971

CCDB · book-ipcn75-78 — Krogulevich 1978

CCDB · book-indian_vol1 — Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov) ; Gregory, W.C. 1941 ; Linnert, G. 1961

CCDB · book-indian_vol1 — Gregory, W.C. 1941

CCDB · book-fedorov — Skaliiiska 1964

CCDB · book-fedorov — CoKoJIOBCKall, CTpeJIKOBa 1938

CCDB · book-fedorov — Gregory W. C. 1941 (

CCDB · book-fedorov — Linnert 1961

CCDB · book-fedorov — Gregory W. C. 1941

CCDB · book-fedorov — KyKOBa 1961

CCDB · iapt — IAPT/IOPB Chromosome Data 17

CCDB · iapt — IAPT/IOPB Chromosome Data 26

CCDB · iapt — IAPT/IOPB Chromosome Data 28

2n 162×CCDB · ipcn-api-dl · CCDB · iapt

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1981. Chromosome numbers of some species of the family Ranunculaceae II. Bot. Zhurn. 66 (12): 1751–1755.

CCDB · iapt — IAPT/IOPB Chromosome Data 34

2n 182×CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-indian_vol1 — Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov)

CCDB · book-fedorov — CoKonoscKaH, CTpenKoBa 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type740 records

Wild obs. + sensor609

Museum / vouchered131

Range

Area of Occupancy AOO2 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 145≤1 km 89≤10 km 39>10 km 251

524 georeferenced · 85 without coordinates

Open the mapobservation + sensor609

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 4≤1 km 5≤10 km 14>10 km 6

29 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	108
Urumqi, CN	7
Beijing, CN	7
Urumqi, CN	2
WNNUlocation not on record	1
Burlington, US	1

6 institutions · 126 of 131 vouchered records shown · 5 without an institution code

09Environmental DNA3 detections

Where the DNA of Aquilegia glandulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)