Aquilegia ganboldii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records2

Data sources4

Biological traits7

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Aquilegia ganboldii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF2 records

DNA & barcodingNCBIsequences

01Narrative

Aquilegia ganboldii là một loài thực vật có hoa trong họ Mao lương. Loài này được Kamelin & Gubanov mô tả khoa học đầu tiên năm 1991.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia ganboldii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSPQ144373.1 ↗608 bp

ACGT

TCGAAACCTGCTCAAGCAGAACGACCCGCGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAGCCCCCGACCGATCCCT …

Aquilegia ganboldii voucher Ganbold E 1310 (NS) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Institution	Specimens
Moscow State Universitylocation not on record	2

1 institutions · 2 of 2 vouchered records shown