Aquilegia eximia

Van Houtte ex Planch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records510

Data sources10

Biological traits13

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Aquilegia eximia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility510 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF510 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT · NCBI≈365 Mbp

01Narrative

Aquilegia eximia est une espèce de plantes à fleurs de la famille des Ranunculaceae. C'est une ancolie endémique à la Californie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.789 mg

⚠ sources differ — TRY: 0.789 mg · GIFT: 0.739 mg

Seed mass max0.987 mg

Seed mass min0.49 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition2 compounds

Compounds documented for Aquilegia eximia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Aporphine alkaloids $ Isoquinoline alkaloids1

Isoquinoline alkaloids $ Protoberberine alkaloids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(+)-Magnoflorine		present	LOTUS
Berberine		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia eximia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLPV564756.1 ↗161 745 bp

ACGT

GTATAATATAATTATTATAATTATATACAAATCATTATGAAATATTTATTCGATGTATTGATGAATGCAATCCGAACAATTACGCCCTAT …

Aquilegia eximia isolate P887 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aquilegia eximia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈365 195 253 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aquilegia eximia0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type510 records

Wild obs. + sensor397

Museum / vouchered112

Fossil1

Origin

Native2

Range

Area of Occupancy AOO784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 226≤1 km 31≤10 km 11>10 km 39

307 georeferenced · 90 without coordinates

Open the mapobservation + sensor397

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 1≤1 km 38≤10 km 29>10 km 1

69 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Luis Obispo, US	19
Santa Barbara, US	11
US	10
Angwin, US	8
Davis, US	7
CASlocation not on record	4
San Francisco, US	4
Canadian Department of Agriculturelocation not on record	4
Claremont, US	3
Arcata, US	3
Riverside, US	2
Tampa, US	2
Fullerton, US	2
Lubbock, US	1
Mexico City, MX	1
Phoenix, US	1
Portland, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
University of Stellenboschlocation not on record	1
KNFHClocation not on record	1

20 institutions · 86 of 112 vouchered records shown · 26 without an institution code

09Environmental DNA1 detections

Where the DNA of Aquilegia eximia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)