Aquilegia atrovinosa

Popov ex Gamajun. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records166

Data sources8

Biological traits18

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Aquilegia atrovinosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility166 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF166 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology5

Leaf width max150 mm

Leaf width min40 mm

Seed mass0.933 mg

Seed mass max0.93 mg

Seed mass min0.93 mg

Life cycle & reproduction3

Flower length max35 mm

Flower length min30 mm

Life formperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max3 600 m

Elevation mean2 700 m

Elevation min1 800 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia atrovinosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLPV564733.1 ↗161 860 bp

ACGT

TATAATAATTATTATATTATTATAATTATATACAAATCATTATGAAATATTTATTCGATGTATTGATGAATGCAATCCGAACAATTACGC …

Aquilegia atrovinosa isolate P933 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aquilegia atrovinosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–162n range14median14mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · book-ipcn67-71 · CCDB · book-fedorov

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

CCDB · book-fedorov — KyKOB8 1961

2n 161×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 14

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type166 records

Wild obs. + sensor111

Museum / vouchered55

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 29≤1 km 33≤10 km 14>10 km 2

78 georeferenced · 33 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	14
Beijing, CN	9
Urumqi, CN	5
Kunming, CN	5
BRNUlocation not on record	5
Nanjing, CN	5
Urumqi, CN	4
CASlocation not on record	3
Yangling, CN	1
Guilin, CN	1
Saint Louis, US	1
GMBAlocation not on record	1
WNNUlocation not on record	1

13 institutions · 55 of 55 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aquilegia atrovinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)