Aquilegia alpina

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Aquilegia

At a glance

Occurrence records10 571

Data sources14

Biological traits16

DNA specimens5

eDNA detections4

Sources14 archives

Databases and archives Aquilegia alpina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 571 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources16 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF10 571 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT587 Mbp

01Narrative

L'ancolie des Alpes est une espèce de plantes herbacées vivace de la famille des Renonculacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLEDAWCVPGIFTTRY

Size & morphology6

Plant height0.475 m

Plant height max0.7 m

Plant height min0.2 m

Seed mass0.964 mg

Seed mass max1 mg

Seed mass min1 mg

Life cycle & reproduction6

Dispersal typeself

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Habitat & environment3

Climatesubalpine or subarctic

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition6 compounds

Compounds documented for Aquilegia alpina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Monomeric stilbenes3

Furofuranoid lignans1

Isoquinoline alkaloids $ Protoberberine alkaloids1

Aporphine alkaloids $ Isoquinoline alkaloids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1-Hydroxypinoresinol 1-O-Beta-D-Glucopyranoside	present	NPASS
(+)-Magnoflorine	present	LOTUS
1-[2-[2-(4-hydroxyphenyl)ethyl]-3,6-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]phenyl]ethanone	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] 4-[2-(4-hydroxyphenyl)ethyl]-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1-benzofuran-2-carboxylate	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] 5-hydroxy-4-[2-(4-hydroxyphenyl)ethyl]-1-benzofuran-2-carboxylate	present	NPASS
Berberine	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilegia alpina has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU729330.1 ↗594 bp

ACGT

GCAGAACGACCCGCGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAGCCCCCGACCGATCCCTTCGCCGTTCCGCGGC …

Aquilegia alpina internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Aquilegia alpina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size586 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aquilegia alpina0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome records14–142n range14median14mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 148×GoaT · Kew Plant DNA C-values Database · CCDB · book-indian_vol1 · CCDB · book-fedorov +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-indian_vol1 — Lewitsky, G.A. (Fedorov) ; Gregory, W.C. 1941 ; Kurita, M. 1957f, 1958a Prazmo, W. 1965

CCDB · book-fedorov — JleBI!TCK:Wi 193fB

CCDB · book-fedorov — Gregory W. C. 1941

CCDB · book-fedorov — Kurita 19!;)8c (I. 1959)

CCDB · book-fedorov — Prazmo 1965

CCDB · book-atlas-flowering-plants — Gregory 1941

CCDB · kew — Ingle J, Timmis JN, Sinclair J. 1975. Relationship between satellite deoxyribonucleic acid, ribosomal ribonucleic acid gene redundancy, and genome size in plants. Plant Physiology 55: 496-501.

n 71×CCDB · book-ipcn65

CCDB · book-ipcn65 — Prazmo 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type10 571 records

Wild obs. + sensor10 046

Museum / vouchered512

Cultivated / captive2

Other11

Range

Area of Occupancy AOO7 900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 1 519≤1 km 340≤10 km 6 515>10 km 506

8 880 georeferenced · 1 166 without coordinates

Open the mapobservation + sensor10 046

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 3≤1 km 14≤10 km 233>10 km 7

257 georeferenced · 255 without coordinates

Open the institutions mapphysical evidence512

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	123
Zürich, CH	103
Zürich, CH	79
Lausanne, CH	36
Glarus, CH	25
LDlocation not on record	22
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	12
Bern, CH	10
Sion, CH	7
Oskarshamn, SE	5
Bronx, US	4
Adam Mickiewicz University in Poznańlocation not on record	4
Auckland, NZ	4
CJBGlocation not on record	3
BClocation not on record	2
Porrentruy, CH	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Monastir, TN	2
Provincia di Livornolocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Moscow State Universitylocation not on record	1
Saint Louis, US	1
Paris, FR	1
Coimbra, PT	1
Chongqing Museumlocation not on record	1

25 institutions · 454 of 512 vouchered records shown · 58 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Aquilegia alpina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aquilegia alpina

At a glance

Sources14 archives

Size & morphology6

Life cycle & reproduction6

Habitat & environment3

Physiology & chemistry1

Compound class profile4 classes

Documented compounds6 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type10 571 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type10 571 records