Aquilaria sinensis

(Lour.) Spreng · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Aquilaria

At a glance

Occurrence records281

Data sources13

Biological traits28

DNA specimens18

eDNA detections14

Sources13 archives

Databases and archives Aquilaria sinensis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility281 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS · NPASS264 compounds

Occurrence & distributionGBIF281 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD · NCBI18 specimens

Genome at a glanceCCDB · GoaT · NCBI914 Mbp

01Narrative

Aquilaria sinensis is a species of plant in the family Thymelaeaceae. It is endemic to China. It is threatened by habitat loss. This medicinal plant is a source of fragrant wood, formed under a pathological condition, called Chen Xiang () in Standard Mandarin, or chàhm hēung in Cantonese, or agarwood.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length25 mm

Fruit length max30 mm

Fruit length min20 mm

Inflorescence length max0.6 cm

Inflorescence length min0.5 cm

Leaf length70 mm

Leaf length max90 mm

Leaf length min50 mm

Leaf width44 mm

Leaf width max60 mm

Leaf width min28 mm

Plant height12.5 m

⚠ sources differ — GIFT: 12.5 m · TRY: 28 m

Plant height max15 m

Plant height min5 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density366 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition264 compounds

Compounds documented for Aquilaria sinensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chromones33

Flavones15

Hydrocarbons11

Unsaturated fatty acids7

Branched fatty acids $ Unsaturated fatty acids6

Documented compounds264 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Cucurbitacin B	present	NPASS
(+)-gamma-Eudesmol	present	NPASS
(+)-lariciresinol	present	LOTUS
(+)-Syringaresinol	present	NPASS
(-)-Balanophonin	present	LOTUS
(1R,13R,14S,21S)-14,21-dihydroxy-17-[2-(4-methoxyphenyl)ethyl]-6-(2-phenylethyl)-7,12,16-trioxapentacyclo[11.7.1.02,11.03,8.015,20]henicosa-2(11),3(8),5,9,15(20),17-hexaene-4,19-dione	present	LOTUS
(1R,13R,14S,21S)-14,21-dihydroxy-6,17-bis(2-phenylethyl)-7,12,16-trioxapentacyclo[11.7.1.02,11.03,8.015,20]henicosa-2(11),3(8),5,9,15(20),17-hexaene-4,19-dione	present	LOTUS
(1R,13R,14S,21S)-14,21-dihydroxy-8,17-bis(2-phenylethyl)-9,12,16-trioxapentacyclo[11.7.1.02,11.05,10.015,20]henicosa-2(11),3,5(10),7,15(20),17-hexaene-6,19-dione	present	LOTUS
(1R,13R,14S,21S)-3,14,21-trihydroxy-8,17-bis[2-(4-methoxyphenyl)ethyl]-9,12,16-trioxapentacyclo[11.7.1.02,11.05,10.015,20]henicosa-2,4,7,10,15(20),17-hexaene-6,19-dione	present	LOTUS
(1R,14R,21S,22S)-21,22-dihydroxy-18-[2-(4-methoxyphenyl)ethyl]-8-(2-phenylethyl)-2,9,13,19-tetraoxapentacyclo[12.7.1.03,12.05,10.015,20]docosa-3(12),4,7,10,15(20),17-hexaene-6,16-dione	present	LOTUS

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilaria sinensis has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes4

GenBank sequences10

eDNA detections14

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP683339.1 ↗460 bp

ACGT

ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTGGGCCGAGGGCACGTCTGCCTGGGTGTCACGCA …

Aquilaria sinensis isolate A.sinensis-wsyy2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★ITS10★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Aquilaria sinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size914 430 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aquilaria sinensis0.91 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · Automatic manuscript search

CCDB · Automatic manuscript search — Azman H. Farah,S. Y. Lee,Zhihui Gao,T. Yao,M. Mado and Rozi Mohamed. 2018. "Genome Size, Molecular Phylogeny, and Evolutionary History of the Tribe Aquilarieae (Thymelaeaceae), the Natural Source of Agarwood". Frontiers in Plant Science 9:n. pag.

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type281 records

Wild obs. + sensor182

Museum / vouchered99

Range

Area of Occupancy AOO860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 181

181 georeferenced · 1 without coordinates

Open the mapobservation + sensor182

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 99 records without

Open the institutions mapphysical evidence99

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	40
Guilin, CN	24
Guangzhou, CN	5
Wuhan, CN	4
Kew, GB	3
Nanjing, CN	3
Kunming, CN	2
Herbarium of South China Botanical Gardenlocation not on record	2
Chengdu, CN	1
Bronx, US	1
Columbia, US	1
Saint Louis, US	1
Cibinong Science Center, Herbarium Bogorienselocation not on record	1

13 institutions · 88 of 99 vouchered records shown · 11 without an institution code

09Environmental DNA14 detections

Where the DNA of Aquilaria sinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 16.8–25.1

Seasonal swing summer↔winter9.40 °C

Max temp (day)24.0 °C 19.6–28.4

Min temp (night)17.2 °C 12.9–21.5

Precipitation324 mm/mo 280–367

Air humidity69.3 % 68.4–70.1

Moisture balance209 mm/mo 148–269

Vapour deficit804 Pa 584–1,024

Wind speed2.40 m/s 1.50–3.40

Cloud cover55.7 % 54.2–57.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)