Aquilaria crassna — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Aquilaria

At a glance

Occurrence records20

Data sources6

Biological traits14

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Aquilaria crassna's data was compiled from.

GBIFGlobal Biodiversity Information Facility20 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF20 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height20 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilaria crassna has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP683315.1 ↗460 bp

ACGT

ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTGGGCCGAGGGCACGTCTGCCTGGGTGTCACGCA …

Aquilaria crassna isolate A.crassna2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL2ITS7ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type20 records

Wild obs. + sensor4

Museum / vouchered16

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 16 records without

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA4 detections

Where the DNA of Aquilaria crassna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.