Aquarius remigis

(Say, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Gerridae/Aquarius

At a glance

Occurrence records14 283

Data sources7

Biological traits0

DNA specimens27

eDNA detections8

Sources7 archives

Databases and archives Aquarius remigis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 283 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 283 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD27 specimens

01Narrative

Aquarius remigis, known as the common water strider, is a species of aquatic bug. It was formerly known as Gerris remigis, but the subgenus Aquarius was elevated to generic rank in 1990 on the basis of phylogenetic analysis.Abstract Aquarius remigis is found throughout North America, but is most prevalent in the mid-west of the United States.Maps

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquarius remigis has left across the world's sequence archives.

At a glance

DNA specimens27

BINs3

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

5Cvariable

25Gvariable

85Cvariable

127Amostly conserved

163Tvariable

355Avariable

370Tmostly conserved

439Amostly conserved

457Cvariable

475Amostly conserved

508Avariable

514Tvariable

526Avariable

542Tmostly conserved

550Amostly conserved

578Tmostly conserved

589Tvariable

628Avariable

631Avariable

637Amostly conserved

643Tmostly conserved

646Tmostly conserved

AACTCTATATTTTATATTAGGTATGTGATCAGGAATAATTGGAATATCTATAAGATGAATTATTCGAATTGAATTAGGTCAACCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes6

BINs3

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gerris insperatussame family10.9%Gerris incognitussame family11.1%Gerris odontogastersame family11.2%Gerris pingreensissame family11.2%Gerris insularissame family11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type14 283 records

Wild obs. + sensor13 106

Museum / vouchered1 177

Origin

Native1

Range

Area of Occupancy AOO30 996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 7 219≤1 km 2 292≤10 km 646>10 km 589

10 746 georeferenced · 2 360 without coordinates

Open the mapobservation + sensor13 106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 54≤1 km 75≤10 km 318>10 km 39

486 georeferenced · 691 without coordinates

Open the institutions mapphysical evidence1 177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	436
Champaign, US	422
Provo, US	98
US	46
San Francisco, US	44
US	36
Sam Noble Oklahoma Museum of Natural Historylocation not on record	19
College Station, US	17
OSUClocation not on record	14
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Colorado State Universitylocation not on record	4
Research Collection of Jen and Hilary Bayerlocation not on record	3
Mayagüez, PR	3
University of Guelphlocation not on record	2
Lubbock, US	2
Awka, NG	2
CUlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Albuquerque, US	1
Washington, US	1
John May Museum of Natural Historylocation not on record	1
Toronto, CA	1
Cornell University Insect Collectionlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Royal Ontario Museumlocation not on record	1
Wuzhou, CN	1
Philadelphia, US	1
Mississippi State, US	1
University of Central Floridalocation not on record	1

29 institutions · 1 167 of 1 177 vouchered records shown · 10 without an institution code

09Environmental DNA8 detections

Where the DNA of Aquarius remigis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

Riparian ZoneWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 11.7–17.2

Seasonal swing summer↔winter22.9 °C

Max temp (day)23.2 °C 17.0–23.2

Min temp (night)11.2 °C 6.20–11.2

Precipitation88.9 mm/mo 88.9–122

Air humidity54.5 % 54.5–57.2

Moisture balance-1.20 mm/mo -5.80–-1.20

Vapour deficit898 Pa 592–898

Wind speed1.30 m/s 1.30–2.00

Cloud cover33.7 % 33.7–35.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aquarius remigis

At a glance

Sources7 archives

At a glance

Record type14 283 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type14 283 records