Aquarius najas

(De Geer, 1773) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Gerridae/Aquarius

At a glance

Occurrence records5 090

Data sources6

Biological traits0

DNA specimens99

eDNA detections97

Sources6 archives

Databases and archives Aquarius najas's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 090 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics99 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 090 records

Environmental DNA1 datasets · 20 countries97 detections

DNA & barcodingBOLD99 specimens

01Narrative

Aquarius najas, also known as the river skater, is a European species of water strider. It was formerly known as Gerris najas, but the subgenus Aquarius was elevated to generic rank in 1990 on the basis of phylogenetic analysis.AbstractAbstract

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding99 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquarius najas has left across the world's sequence archives.

At a glance

DNA specimens99

BINs2

Marker genes2

eDNA detections97

Countries21

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

34Amostly conserved

304Amostly conserved

312Cmostly conserved

316Gmostly conserved

331Amostly conserved

343Gmostly conserved

409Amostly conserved

418Amostly conserved

559Amostly conserved

631Gmostly conserved

641Tmostly conserved

CACATTATATTTTATATTAGGCATGTGATCAGGAATAATTGGTATATCAATAAGATGAATTATTCGAATTGAATTGGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes6

BIN1

Most divergent pair2.4%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aquarius cinereussame genus4.7%Gerris latiabdominissame family10.5%Gerris pingreensissame family10.9%Gerris gracilicornissame family11.3%Gerris thoracicussame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type5 090 records

Wild obs. + sensor4 375

Museum / vouchered714

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO10 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 1 856≤1 km 522≤10 km 1 269>10 km 42

3 689 georeferenced · 686 without coordinates

Open the mapobservation + sensor4 375

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 232≤1 km 108≤10 km 63

403 georeferenced · 311 without coordinates

Open the institutions mapphysical evidence714

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	186
DanBIFlocation not on record	136
Tartu, EE	45
Helsinki, FI	31
NHMOlocation not on record	30
Nijmegen, NL	22
Stockholm, SE	21
John May Museum of Natural Historylocation not on record	19
Bonn, DE	8
Philadelphia, US	8
Jyväskylä, FI	8
NTNU-VMlocation not on record	6
DEMNA-DNElocation not on record	5
BioFokuslocation not on record	3
Natural History Museum, Londonlocation not on record	3
South Kensington, GB	3
NCMGlocation not on record	3
Tallinn, EE	3
ZSMlocation not on record	3
CIBIOlocation not on record	1
Naturhistorisches Museum Wienlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
CBDClocation not on record	1
Universite de Montpellierlocation not on record	1

24 institutions · 548 of 714 vouchered records shown · 107 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA97 detections

Where the DNA of Aquarius najas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys1

Countries20

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map20 countries0

streamStream

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 2.50–20.0

Seasonal swing summer↔winter19.2 °C

Max temp (day)18.5 °C 5.20–23.0

Min temp (night)9.00 °C -0.7–15.9

Precipitation68.5 mm/mo 33.4–92.2

Air humidity62.5 % 53.1–65.4

Moisture balance-20.6 mm/mo -61.7–32.9

Vapour deficit758 Pa 330–963

Wind speed2.80 m/s 1.30–4.60

Cloud cover40.9 % 32.7–52.5

CHELSA 1981–2010, ~9 km grid, at location & month of 95 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aquarius najas

At a glance

Sources6 archives

At a glance

Record type5 090 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 090 records