Apus affinis

(J.E.Gray, 1830) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Apodiformes/Apodidae/Apus

At a glance

Occurrence records496 327

Data sources9

Biological traits0

DNA specimens11

eDNA detections0

Sources9 archives

Databases and archives Apus affinis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility496 322 records↗

OBISOcean Biodiversity Information System5 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS496 327 records

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · NCBI1.3 Gbp

01Narrative

Le Martinet des maisons, aussi Martinet à croupion blanc, Martinet à dos blanc ou Martinet cul-blanc, est une espèce d'oiseaux de petite taille de la famille des Apodidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apus affinis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P629 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

114Gmostly conserved

188Cmostly conserved

200Gvariable

296Amostly conserved

320Amostly conserved

446Tmostly conserved

469Cmostly conserved

503Cmostly conserved

533Tvariable

616Amostly conserved

617Tmostly conserved

CCGGCATAGTCGGAACTGCCCTCAGCCTACTTATCCGAGCAGAACTTGGACAACCAGGAACTCTCCTAGGAGATGACCAAATCTACAACG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes3

BIN1

Most divergent pair0.48%

AfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apus pallidussame genus3.0%Apus apussame genus4.0%Apus pacificussame genus4.3%Chaetura pelagicasame family9.6%Aerodramus fuciphagussame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apus affinis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 349 640 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apus affinis1.35 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Chromosome records70–702n range70median70mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 702×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type496 327 records

Wild obs. + sensor495 965

Museum / vouchered192

Cultivated / captive29

Other141

Origin

Native131

Range

Area of Occupancy AOO209 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 3 418≤1 km 1 272≤10 km 487>10 km 144

5 321 georeferenced · 490 644 without coordinates

Open the mapobservation + sensor495 965

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 3≤1 km 33≤10 km 17>10 km 3

56 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence192

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 27

27 georeferenced · 2 without coordinates

Open the mapnot free-living29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	34
Ann Arbor, US	23
MRAClocation not on record	19
Philadelphia, US	12
US	11
Seattle, US	9
Washington, US	8
Bonn, DE	6
Wuzhou, CN	6
Geneva, CH	6
South Kensington, GB	6
Toronto, CA	5
Brussels, BE	4
Instituto de Investigação Científica Tropicallocation not on record	4
RBINS-Scientific Heritagelocation not on record	3
National Museums of Kenyalocation not on record	2
Delaware Museum of Nature and Sciencelocation not on record	2
KU Leuvenlocation not on record	1
Paris, FR	1
Nagatoro-machi, Chichibu-gun, JP	1
MNHAHlocation not on record	1
Chicago, US	1
Berkeley, US	1
München, DE	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1

25 institutions · 168 of 192 vouchered records shown · 20 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apus affinis

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type496 327 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 25 geolocated

Cultivated / Captivenot free-living

Record type496 327 records