Aptychotrema vincentiana

(Haacke, 1885) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rhinopristiformes/Rhinobatidae/Aptychotrema

At a glance

Occurrence records1 219

Data sources9

Biological traits5

DNA specimens12

eDNA detections8

Sources9 archives

Databases and archives Aptychotrema vincentiana's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility795 records↗

OBISOcean Biodiversity Information System424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS1 219 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD12 specimens

01Narrative

The southern shovelnose ray, western shovelnose ray, or yellow shovelnose ray (Aptychotrema vincentiana) is a species of fish in the Rhinobatidae family. It is endemic to southern Australia. Its natural habitats are open seas and shallow seas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length84 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max125 m

Vulnerability53.6

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aptychotrema vincentiana has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.37%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

175Cmostly conserved

232Cmostly conserved

275Tmostly conserved

415Cmostly conserved

490Avariable

592Tvariable

CTTATATTTGATTTTTGGTGCCTGAGCAGGAATAGTTGGAACCGGTCTAAGTTTACTTATTCGAACAGAACTTAGTCAACCTGGAGCACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aptychotrema rostratasame genus2.6%Zapteryx brevirostrissame family11.4%Trygonorrhina dumeriliisame family15.8%Pristis perottetisame order16.0%Chlamydoselachus anguineussame order17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 219 records

Wild obs. + sensor941

Museum / vouchered278

Origin

Native1

Range

Area of Occupancy AOO1 656 km²

Depth

0–200 m sunlit174

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 37.5 m · max 197 m · 174 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 267≤1 km 370≤10 km 34>10 km 168

839 georeferenced · 102 without coordinates

Open the mapobservation + sensor941

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 38≤1 km 115≤10 km 17>10 km 19

189 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence278

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	98
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	14
Western Australian Museumlocation not on record	12
DEWlocation not on record	6
Museums Victorialocation not on record	5
Sydney, AU	3
CSIRO, Australian National Fish Collectionlocation not on record	3
New Haven, US	1
Paris, FR	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
Natick, US	1

11 institutions · 145 of 278 vouchered records shown · 14 without an institution code

09Environmental DNA8 detections

Where the DNA of Aptychotrema vincentiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 19.6–21.7

Seasonal swing summer↔winter7.60 °C

Max temp (day)21.1 °C 21.1–23.9

Min temp (night)17.5 °C 17.5–19.4

Precipitation48.4 mm/mo 43.1–50.4

Air humidity55.0 % 55.0–56.0

Vapour deficit1,019 Pa 1,019–1,157

Cloud cover22.3 % 21.6–23.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aptychotrema vincentiana

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Other traits2

At a glance

Record type1 219 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 219 records