Aptosimum lineare

Marloth & Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Aptosimum

At a glance

Occurrence records752

Data sources5

Biological traits16

DNA specimens4

eDNA detections3

Sources5 archives

Databases and archives Aptosimum lineare's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility752 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF752 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Aptosimum lineare là một loài thực vật có hoa trong họ Huyền sâm. Loài này được Marloth & Engl. mô tả khoa học đầu tiên năm 1889.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.4 m

Plant height min0.01 m

Seed mass0.161 mg

Seed mass max0.22 mg

Seed mass min0.1 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 800 m

Elevation min150 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aptosimum lineare has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences1

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMZ461572.1 ↗552 bpSouth Africa · 2015

ACGT

GCAAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCA …

Aptosimum lineare voucher PUC<ZAF>:0015309-0 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type752 records

Wild obs. + sensor445

Museum / vouchered307

Range

Area of Occupancy AOO2 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 272≤1 km 53≤10 km 17>10 km 17

359 georeferenced · 86 without coordinates

Open the mapobservation + sensor445

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 307 records without

Open the institutions mapphysical evidence307

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	247
Kew, GB	13
University of Stellenboschlocation not on record	5
Cape Town, ZA	4
MeiseBGlocation not on record	3
Saint Louis, US	3
University of Johannesburglocation not on record	2
Paris, FR	1
Boise, US	1
North-West University, A.P. Goossens Herbariumlocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Frankfurt am Main	1
Instituto de Investigação Científica Tropicallocation not on record	1

13 institutions · 283 of 307 vouchered records shown · 24 without an institution code

09Environmental DNA3 detections

Where the DNA of Aptosimum lineare was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 23.0–26.0

Seasonal swing summer↔winter9.20 °C

Max temp (day)30.2 °C 27.8–30.6

Min temp (night)20.5 °C 17.7–20.9

Precipitation94.0 mm/mo 84.8–97.2

Air humidity58.1 % 55.0–58.3

Moisture balance-60.9 mm/mo -69.5–-60.5

Vapour deficit1,364 Pa 1,266–1,412

Wind speed2.90 m/s 2.70–3.50

Cloud cover42.6 % 31.1–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)