Aptosimum arenarium

Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Aptosimum

At a glance

Occurrence records81

Data sources3

Biological traits17

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Aptosimum arenarium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

NCBIUS National Library of Medicinesequences↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF81 records

DNA & barcodingNCBIsequences

01Narrative

Aptosimum arenarium là một loài thực vật có hoa trong họ Huyền sâm. Loài này được Engl. mô tả khoa học đầu tiên năm 1889.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.5 m

Plant height min0.01 m

Seed mass0.181 mg

Seed mass max0.18 mg

Seed mass min0.18 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 830 m

Elevation min1 000 m

Epiphyteterrestrial

Growth formherb

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aptosimum arenarium has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW546354.1 ↗677 bpNamibia

ACGT

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCACAGCAGACCGCGAACACGTGTTTTAACTACAACATTGGGGCCGGT …

Aptosimum arenarium voucher Medina, LM6056 (MA) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type81 records

Wild obs. + sensor41

Museum / vouchered40

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 16≤1 km 11≤10 km 2>10 km 1

30 georeferenced · 11 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 40 records without

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	35
University of Stellenboschlocation not on record	1
MAlocation not on record	1
Kew, GB	1

4 institutions · 38 of 40 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)