Aptinothrips rufus

(Haliday, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Thysanoptera/Thripidae/Aptinothrips

At a glance

Occurrence records1 369

Data sources8

Biological traits0

DNA specimens252

eDNA detections425

Sources8 archives

Databases and archives Aptinothrips rufus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 369 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI425 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics252 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 369 records

Environmental DNA6 datasets · 9 countries425 detections

DNA & barcodingBOLD252 specimens

Genome at a glanceGoaT · NCBI≈340 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding252 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aptinothrips rufus has left across the world's sequence archives.

At a glance

DNA specimens252

BINs8

Marker genes5

eDNA detections425

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P327 bp consensus229 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 73% of positions are identical in every specimen.

Where individuals differ — all 87 variable positions, in barcode order

2Tmostly conserved

4Amostly conserved

7Tvariable

10Tvariable

13Tmostly conserved

16Avariable

19Avariable

32Gmostly conserved

34Cmostly conserved

37Tmostly conserved

40Cvariable

43Avariable

44Tmostly conserved

46Avariable

49Tvariable

52Tmostly conserved

58Tmostly conserved

64Tvariable

65Gvariable

67Amostly conserved

70Gvariable

76Amostly conserved

79Cvariable

80Tmostly conserved

82Tvariable

85Tvariable

88Tmostly conserved

94Tvariable

97Tmostly conserved

106Avariable

109Avariable

110Gmostly conserved

112Tmostly conserved

115Cvariable

121Cvariable

122Tmostly conserved

127Tmostly conserved

130Tmostly conserved

136Cmostly conserved

139Tmostly conserved

142Cvariable

143Tmostly conserved

145Amostly conserved

148Tmostly conserved

154Avariable

157Tmostly conserved

158Tmostly conserved

160Avariable

164Amostly conserved

171Gvariable

172Amostly conserved

173Tmostly conserved

175Amostly conserved

177Avariable

178Tvariable

181Amostly conserved

190Amostly conserved

199Tmostly conserved

208Amostly conserved

212Amostly conserved

214Tmostly conserved

223Amostly conserved

224Amostly conserved

226Tvariable

229Tmostly conserved

230Tmostly conserved

239Tmostly conserved

244Amostly conserved

247Avariable

250Avariable

259Amostly conserved

268Tmostly conserved

272Cvariable

274Amostly conserved

275Tmostly conserved

277Amostly conserved

286Tvariable

289Tmostly conserved

290Tmostly conserved

295Tmostly conserved

298Tmostly conserved

310Cmostly conserved

313Tvariable

316Avariable

319Gvariable

322Tvariable

325Amostly conserved

ATCAGGTGATGGTGCAGGAACAGGTTGAACAGTCTATCCCCCATTATCTACTTTTTATCATTCTGGAATGTCAGTAGACTTTACTATTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 57 variants.

Diversity (π)9.5%

Haplotypes57

BINs8

Most divergent pair19.6%

EuropeOtherN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS216S18S-3P18S-5P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aptinothrips rufus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈339 926 289 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aptinothrips rufus0.34 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness96.3% BUSCO

08Occurrence & distribution

Record type1 369 records

Wild obs. + sensor552

Museum / vouchered809

Other8

Origin

Introduced41

Range

Area of Occupancy AOO1 520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 14≤1 km 525≤10 km 8>10 km 2

549 georeferenced · 3 without coordinates

Open the mapobservation + sensor552

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 81≤1 km 370≤10 km 128>10 km 2

581 georeferenced · 228 without coordinates

Open the institutions mapphysical evidence809

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	230
MWLRlocation not on record	205
New Zealand Arthropod Collectionlocation not on record	108
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	47
UAclocation not on record	41
Norwegian Institute of Bioeconomy Researchlocation not on record	31
Australian National Fish Collectionlocation not on record	28
MZLUlocation not on record	17
University of Guelph, Centre for Biodiversity Genomicslocation not on record	14
SLU Artdatabankenlocation not on record	14
NTNU-VMlocation not on record	11
Provo, US	9
University of Alberta Museums (UAM)location not on record	8
DPIlocation not on record	6
Auckland, NZ	4
Helsinki, FI	3
US	3
South Kensington, GB	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
BioFokuslocation not on record	1
Sydney, AU	1
Tasmanian Museum & Art Gallerylocation not on record	1

22 institutions · 785 of 809 vouchered records shown · 24 without an institution code

09Environmental DNA425 detections

Where the DNA of Aptinothrips rufus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found425

Studies independent surveys6

Countries9

Verifiable raw sequence linked133

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 425 detections have coordinates

Open the map9 countries0

1. Forest & WoodlandForestPond1. Forest & Woodland|1.4. Temperate Forest14. Artificial - Terrestrial|14.5 Urban AreasGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.10 4.80–5.40

Conductivity226 µS/cm 71.0–1,779

Organic carbon3.75 % 2.06–4.19

Water content11.2 %

Nitrate-N6.00 mg/kg 2.00–7.00

Phosphorus39.0 mg/kg 17.0–66.0

Clay16.8 % 16.4–17.1

Sand66.3 % 63.5–69.1

Depth0 m 0–0.2

air [ENVO:00002005]SoilLatLon out of rangeChromosolsRudosol

3 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 10.9–17.2

Seasonal swing summer↔winter17.0 °C

Max temp (day)18.2 °C 14.3–21.7

Min temp (night)11.2 °C 7.10–14.5

Precipitation72.5 mm/mo 35.5–99.6

Air humidity61.1 % 57.3–67.9

Moisture balance-55.2 mm/mo -91.9–36.7

Vapour deficit665 Pa 451–809

Wind speed3.60 m/s 2.40–5.50

Cloud cover43.8 % 39.8–55.2

CHELSA 1981–2010, ~9 km grid, at location & month of 236 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aptinothrips rufus

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 369 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 369 records