Aptesis nigrocincta

(Gravenhorst, 1815) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Aptesis

At a glance

Occurrence records538

Data sources6

Biological traits0

DNA specimens98

eDNA detections1 095

Sources6 archives

Databases and archives Aptesis nigrocincta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility538 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 095 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics98 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF538 records

Environmental DNA3 datasets · 11 countries1 095 detections

DNA & barcodingBOLD98 specimens

01Narrative

Aptesis nigrocincta is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de gewone sluipwespen (Ichneumonidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Gravenhorst in 1815.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding98 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aptesis nigrocincta has left across the world's sequence archives.

At a glance

DNA specimens98

BINs2

Marker genes1

eDNA detections1 095

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus89 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

5Avariable

21Amostly conserved

65Amostly conserved

74Cmostly conserved

80Tmostly conserved

86Tmostly conserved

104Tmostly conserved

113Cmostly conserved

155Cvariable

170Tmostly conserved

182Avariable

188Tmostly conserved

269Cmostly conserved

272Tmostly conserved

282Avariable

284Gvariable

315Gmostly conserved

320Cmostly conserved

338Tmostly conserved

358Tmostly conserved

368Amostly conserved

392Cmostly conserved

413Avariable

422Tmostly conserved

447Amostly conserved

466Gmostly conserved

548Tmostly conserved

566Tmostly conserved

611Tmostly conserved

614Tmostly conserved

626Amostly conserved

629Amostly conserved

TTTTATATTTTATTTTTGGTATATGATCTGGTATAATTGGATCTTCAATAAGTTTAATTATCCGAATAGAACTCAGAAATCCAGGTTATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes19

BINs2

Most divergent pair4.4%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adelognathus chrysopygussame family13.7%Endromopoda nigricoxissame family13.8%Scambus longicorpussame family13.9%Gambrus carnifexsame family14.4%Oresbius castaneussame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type538 records

Wild obs. + sensor381

Museum / vouchered157

Range

Area of Occupancy AOO1 528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 125≤1 km 51≤10 km 164>10 km 2

342 georeferenced · 39 without coordinates

Open the mapobservation + sensor381

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 24≤1 km 23≤10 km 41>10 km 8

96 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence157

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	24
Stockholm, SE	21
Natural History Museum Rotterdamlocation not on record	20
Tromsø, NO	14
University of Guelph, Centre for Biodiversity Genomicslocation not on record	11
neflocation not on record	9
ZSMlocation not on record	7
Gothenburg, SE	7
NTNU-VMlocation not on record	6
NHMOlocation not on record	5
Bavarian State Collection of Zoologylocation not on record	4
South Kensington, GB	4
SLU Artdatabankenlocation not on record	2
Champaign, US	2
Olocation not on record	1
Philadelphia, US	1

16 institutions · 138 of 157 vouchered records shown · 19 without an institution code

09Environmental DNA1 095 detections

Where the DNA of Aptesis nigrocincta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 095

Studies independent surveys3

Countries11

Verifiable raw sequence linked980

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 095 detections have coordinates

Open the map11 countries0

UrbanHay meadowForestFen edgeForest edge (suburban)Bog edge in alpine birch forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.2–17.2

Seasonal swing summer↔winter18.4 °C

Max temp (day)18.6 °C 14.1–20.9

Min temp (night)11.0 °C 8.00–13.7

Precipitation84.0 mm/mo 59.1–122

Air humidity61.2 % 58.5–64.2

Moisture balance-12.6 mm/mo -55.5–44.1

Vapour deficit662 Pa 487–780

Wind speed2.80 m/s 2.20–4.30

Cloud cover48.5 % 41.1–58.0

CHELSA 1981–2010, ~9 km grid, at location & month of 1 095 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)