Apteryx rowi

Tennyson, Palma, Robertson, Worthy & B.J.Gill, 2003 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Apterygiformes/Apterygidae/Apteryx

At a glance

Occurrence records717

Data sources11

Biological traits28

DNA specimens7

eDNA detections7

Sources11 archives

Databases and archives Apteryx rowi's data was compiled from.

WikipediaWikimedia Foundation15 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility717 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources28 traits

Occurrence & distributionGBIF717 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

The Okarito kiwi (Apteryx rowi), also known as the rowi or Okarito brown kiwi, is a member of the kiwi family Apterygidae, described as new to science in 2003. The species is part of the brown kiwi complex, and is morphologically very similar to other members of that complex. It is found in a restricted area of the Ōkārito forest on the West Coast of New Zealand's South Island, and has a population of only about 600 birds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONET

Size & morphology13

Beak depth5.3 mm

Beak length (culmen)157 mm

Beak length (nares)2.4 mm

Beak width4.7 mm

Body mass2 600 g

⚠ sources differ — AmnioteDB: 2 600 g · AVONET: 1 924 g

Body mass (female)2 725 g

Body mass (male)2 225 g

Hand-wing index0.1

Kipp's distance0.1 mm

Secondary length0.1 mm

Tail length0.1 mm

Tarsus length84 mm

Wing length0.1 mm

Life cycle & reproduction9

Age at maturity (male)548 days

Age at sexual maturity1 461 days

Egg mass430 g

Fledging age6 days

Incubation79 days

Litter size1

Litters per year1.25 /year

Max. longevity480 months

Neonate mass325 g

Diet & foraging2

Trophic levelcarnivore

Trophic nicheInvertivore

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleTerrestrial

Range size239 km²

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apteryx rowi has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 551 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

GTGACCTTTACTACTCGATGACTCTTCTCAACTAACCATAAAGATATCGGTACACTATATCTCATTTTCGGTGCATGAGCAGGCATAGTA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_052824 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apteryx rowi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 228 902 913 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apteryx rowi1.23 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.9% BUSCO

07Deep time~3.8 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin3.8 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Environmentterrestrial

Life habitground dwelling, solitary

Dietcarnivore

Motilityactively mobile

Compositionhydroxyapatite

Reproductionoviparous, dispersal=direct/internal,mobile

Ontogenyaccretion,modification of parts

08Occurrence & distribution

Record type717 records

Wild obs. + sensor713

Museum / vouchered4

Origin

Native1

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 10≤1 km 3>10 km 26

39 georeferenced · 674 without coordinates

Open the mapobservation + sensor713

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA7 detections

Where the DNA of Apteryx rowi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.50 °C 1.90–9.40

Seasonal swing summer↔winter10.4 °C

Max temp (day)11.6 °C 3.90–11.6

Min temp (night)5.00 °C -1.80–6.40

Precipitation358 mm/mo 334–402

Air humidity66.4 % 64.0–67.1

Moisture balance283 mm/mo 229–337

Vapour deficit365 Pa 246–420

Wind speed5.00 m/s 3.40–5.20

Cloud cover37.5 % 36.2–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)