Apterogenum ypsillon

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apterogenum

At a glance

Occurrence records20 595

Data sources6

Biological traits2

DNA specimens41

eDNA detections46

Sources6 archives

Databases and archives Apterogenum ypsillon's data was compiled from.

GBIFGlobal Biodiversity Information Facility20 595 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF20 595 records

Environmental DNA2 datasets · 11 countries46 detections

DNA & barcodingBOLD41 specimens

Genome at a glanceGoaT · NCBI≈715 Mbp

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apterogenum ypsillon has left across the world's sequence archives.

At a glance

DNA specimens41

BINs1

Marker genes1

eDNA detections46

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

31Gvariable

118Tmostly conserved

199Avariable

217Amostly conserved

229Gmostly conserved

235Cvariable

274Cvariable

304Cmostly conserved

427Cvariable

544Amostly conserved

AACGTTATATTTTATTTTTGGAATTTGAGCGGGAATAGTAGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.53%

Haplotypes7

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eremohadena immundasame family4.3%Enargia decolorsame family4.4%Leucochlaena turatiisame family4.6%Leucochlaena oditissame family4.6%Enargia infumatasame family4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apterogenum ypsillon carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈715 127 636 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apterogenum ypsillon0.72 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.2% BUSCO

08Occurrence & distribution

Record type20 595 records

Wild obs. + sensor20 284

Museum / vouchered242

Other69

Origin

Native481

Range

Area of Occupancy AOO18 728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 1 704≤1 km 371≤10 km 17 605>10 km 32

19 712 georeferenced · 572 without coordinates

Open the mapobservation + sensor20 284

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 12≤1 km 91≤10 km 50>10 km 3

156 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence242

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	53
Salzburg, AT	48
Zürich, CH	46
Natural History Museum Rotterdamlocation not on record	26
Nijmegen, NL	17
Provincia di Livornolocation not on record	13
CBDClocation not on record	9
UMUlocation not on record	7
John May Museum of Natural Historylocation not on record	5
NMOKlocation not on record	4
ZSMlocation not on record	2
NHMOlocation not on record	2
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1

14 institutions · 234 of 242 vouchered records shown · 8 without an institution code

09Environmental DNA46 detections

Where the DNA of Apterogenum ypsillon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys2

Countries11

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map11 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 9.70–18.7

Seasonal swing summer↔winter18.8 °C

Max temp (day)20.4 °C 14.3–23.1

Min temp (night)12.1 °C 4.30–14.0

Precipitation72.6 mm/mo 52.9–127

Air humidity60.3 % 56.9–62.4

Moisture balance-39.1 mm/mo -74.1–24.6

Vapour deficit734 Pa 491–905

Wind speed2.90 m/s 1.90–4.00

Cloud cover37.9 % 33.4–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apterogenum ypsillon

At a glance

Sources6 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type20 595 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 595 records