Apterobittacus apterus

(MacLachlan, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Mecoptera/Bittacidae/Apterobittacus

At a glance

Occurrence records220

Data sources6

Biological traits0

DNA specimens6

eDNA detections1

Sources6 archives

Databases and archives Apterobittacus apterus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility220 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF220 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD6 specimens

01Narrative

Apterobittacus is a genus of hangingflies in the family Bittacidae. There is one described species in Apterobittacus, A. apterus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apterobittacus apterus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

29Gvariable

102Gmostly conserved

164Amostly conserved

215Avariable

266Avariable

350Cmostly conserved

446Tmostly conserved

455Amostly conserved

494Amostly conserved

CCTTATATTTTATCTTCGGAGCTTGATCGGGAATAGTGGGAACTTCATTAAGTTTACTTATTCGAGCTGAACTAGGACAACCTGGGGCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes3

BIN1

Most divergent pair0.92%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Panorpa cognatasame order13.6%Panorpa reflexasame order14.7%Helina lasiophthalmasame order15.0%Hydrotaea velutinasame order15.3%Phorinia aurifronssame order15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type220 records

Wild obs. + sensor174

Museum / vouchered46

Origin

Native1

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 116≤1 km 19≤10 km 6>10 km 4

145 georeferenced · 29 without coordinates

Open the mapobservation + sensor174

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 1≤1 km 3≤10 km 5>10 km 10

19 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	30
Cambridge, US	15
Los Angeles, US	1

3 institutions · 46 of 46 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Apterobittacus apterus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)