Aptenopedes sphenarioides

Scudder, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Aptenopedes

At a glance

Occurrence records1 214

Data sources8

Biological traits0

DNA specimens7

eDNA detections4

Sources8 archives

Databases and archives Aptenopedes sphenarioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 214 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD7 specimens

01Narrative

Aptenopedes sphenarioides, the linear-winged grasshopper, is a species of spur-throated grasshopper in the family Acrididae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aptenopedes sphenarioides has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes2

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 56 variable positions, in barcode order

25Gmostly conserved

28Avariable

55Tvariable

61Tmostly conserved

67Gvariable

76Amostly conserved

82Amostly conserved

88Amostly conserved

112Cmostly conserved

124Tvariable

133Cmostly conserved

136Tmostly conserved

148Gvariable

154Cmostly conserved

160Amostly conserved

206Cmostly conserved

217Tvariable

226Tvariable

235Cvariable

247Cvariable

271Amostly conserved

274Amostly conserved

283Amostly conserved

287Cmostly conserved

298Tmostly conserved

304Gmostly conserved

316Amostly conserved

325Tmostly conserved

343Tmostly conserved

346Gvariable

367Cvariable

373Amostly conserved

376Gvariable

379Amostly conserved

382Tmostly conserved

397Tmostly conserved

418Amostly conserved

427Cmostly conserved

428Tmostly conserved

490Cmostly conserved

496Cmostly conserved

499Tmostly conserved

548Tvariable

556Cvariable

562Cmostly conserved

565Amostly conserved

571Tvariable

578Tmostly conserved

586Tmostly conserved

595Cmostly conserved

616Tmostly conserved

625Tmostly conserved

628Gmostly conserved

634Tmostly conserved

646Cmostly conserved

652Tmostly conserved

TACTTTATACTTTATATTTGGTGCGTGAGCTGGAATAGTAGGAACATCAATAAGTATAATTATTCGGGCAGAATTAGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes3

BINs3

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sinopodisma wulingshanasame family9.3%Emeiacris maculatasame family9.7%Melanoplus brunerisame family9.9%Melanoplus washingtoniussame family10.0%Melanoplus punctulatussame family10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 214 records

Wild obs. + sensor225

Museum / vouchered989

Range

Area of Occupancy AOO1 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 89≤1 km 53≤10 km 16>10 km 9

167 georeferenced · 58 without coordinates

Open the mapobservation + sensor225

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 187≤10 km 156>10 km 399

742 georeferenced · 247 without coordinates

Open the institutions mapphysical evidence989

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	38
CUlocation not on record	31
University of Central Floridalocation not on record	24
Champaign, US	12
Mississippi State, US	6
University of Guelphlocation not on record	5
Colorado State Universitylocation not on record	4
Provo, US	3

8 institutions · 123 of 989 vouchered records shown · 866 without an institution code

09Environmental DNA4 detections

Where the DNA of Aptenopedes sphenarioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 25.5–25.5

Seasonal swing summer↔winter10.8 °C

Max temp (day)31.0 °C

Min temp (night)20.2 °C

Precipitation88.2 mm/mo

Air humidity56.9 %

Moisture balance-96.3 mm/mo

Vapour deficit1,395 Pa

Wind speed3.70 m/s

Cloud cover29.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aptenopedes sphenarioides

At a glance

Sources8 archives

At a glance

Record type1 214 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 214 records