Apsilus dentatus

Guichenot, 1853 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Lutjanidae/Apsilus

At a glance

Occurrence records109

Data sources10

Biological traits8

DNA specimens10

eDNA detections10

Sources10 archives

Databases and archives Apsilus dentatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

OBISOcean Biodiversity Information System56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS109 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Apsilus dentatus, the black snapper, is a species of marine ray-finned fish, a snapper belonging to the family Lutjanidae. It is found in the western Atlantic Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length65 cm

Body mass3 170 g

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max300 m

Depth min40 m

Vulnerability28.05

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apsilus dentatus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

2Cmostly conserved

57Tmostly conserved

106Gmostly conserved

274Tvariable

342Cmostly conserved

499Amostly conserved

529Tmostly conserved

544Cmostly conserved

CCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCCCTAAGTCTGCTCATTCGAGCAGAACTGAGCCAACCAGGCGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes5

BIN1

Most divergent pair0.61%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lipocheilus carnolabrumsame family8.6%Etelis carbunculussame family11.2%Etelis coruscanssame family11.2%Etelis oculatussame family11.3%Paracaesio xanthurasame family11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type109 records

Wild obs. + sensor29

Museum / vouchered80

Origin

Native2

Range

Area of Occupancy AOO240 km²

Depth

0–200 m sunlit19

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 106.5 m · max 141 m · 19 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 3>10 km 7

10 georeferenced · 19 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 1≤10 km 4>10 km 13

18 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
Cambridge, US	5
Tapachula, MX	4
Washington, US	3
New Haven, US	2
FishBaselocation not on record	2
Wuzhou, CN	2
CASlocation not on record	1
Universidad del Valle de Guatemalalocation not on record	1
Paris, FR	1
Los Angeles, US	1
North Carolina Museum of Natural Scienceslocation not on record	1
Universidad del Valle (UniValle)location not on record	1
University of California San Diegolocation not on record	1
Texas Cooperative Wildlife Collectionlocation not on record	1
Chicago, US	1

16 institutions · 39 of 80 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Apsilus dentatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 24.7–26.3

Seasonal swing summer↔winter3.00 °C

Max temp (day)26.2 °C 25.6–27.0

Min temp (night)24.9 °C 23.9–25.3

Precipitation47.6 mm/mo 39.6–194

Air humidity61.0 % 60.4–62.8

Vapour deficit1,257 Pa 1,216–1,298

Cloud cover27.5 % 23.7–31.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)